Miyakogusa Predicted Gene
- Lj0g3v0041139.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0041139.1 Non Chatacterized Hit- tr|E9AKQ4|E9AKQ4_LEIMU
Putative 5'-3' exonuclease OS=Leishmania mexicana
(str,33.93,1.2,seg,NULL,CUFF.1900.1
(360 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66758 101 3e-21
>gnl|LJGI|TC66758
Length = 585
Score = 101 bits (51), Expect = 3e-21
Identities = 61/63 (96%), Gaps = 1/63 (1%)
Strand = Plus / Minus
Query: 86 aatctggattctgggtcatgctctgctcttccttcttcctctcctgcaagttctggttct 145
|||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 aatctggattatgg-tcatgctctgctcttccttcttcctctcctgcaagttctggttct 407
Query: 146 ggg 148
|||
Sbjct: 406 ggg 404