Miyakogusa Predicted Gene
- Lj0g3v0040109.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0040109.1 Non Chatacterized Hit- tr|I3SH39|I3SH39_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=4
SV=1,100,0,Auxin_inducible,Auxin responsive SAUR protein; seg,NULL;
FAMILY NOT NAMED,NULL,CUFF.1893.1
(279 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind... 553 e-157
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu... 157 4e-38
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu... 137 4e-32
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu... 105 1e-22
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu... 90 8e-18
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind... 72 2e-12
gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-ind... 60 7e-09
>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
Glycine max|Rep: Auxin-induced protein 6B - Glycine max
(Soybean), complete
Length = 494
Score = 553 bits (279), Expect = e-157
Identities = 279/279 (100%)
Strand = Plus / Minus
Query: 1 atgggttttcgtttacttgctattcgacgagcatcattcacttctagccaagcagcttca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 388 atgggttttcgtttacttgctattcgacgagcatcattcacttctagccaagcagcttca 329
Query: 61 aaatctgttaaagtttcgaagggctatcttgcagtgtatgttggagaagaacagaagagg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 aaatctgttaaagtttcgaagggctatcttgcagtgtatgttggagaagaacagaagagg 269
Query: 121 tttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgagtcaagct 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268 tttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgagtcaagct 209
Query: 181 gaggacgagtttggatatgatcatcccatgggtggcctcacaattccttgcagcgaagat 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208 gaggacgagtttggatatgatcatcccatgggtggcctcacaattccttgcagcgaagat 149
Query: 241 gtcttccaacagataactactcacttgaatgggctctaa 279
|||||||||||||||||||||||||||||||||||||||
Sbjct: 148 gtcttccaacagataactactcacttgaatgggctctaa 110
>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (80%)
Length = 528
Score = 157 bits (79), Expect = 4e-38
Identities = 195/233 (83%), Gaps = 3/233 (1%)
Strand = Plus / Plus
Query: 1 atgggttttcgtttacttgctattcgacgagcatcattcacttctagccaagcagcttca 60
|||||||| ||| ||||||||||| | || ||||| |||||| ||||||||||||||
Sbjct: 95 atgggtttccgtatacttgctattaggcgggcatccttcactg---gccaagcagcttca 151
Query: 61 aaatctgttaaagtttcgaagggctatcttgcagtgtatgttggagaagaacagaagagg 120
||||||| |||| | ||||| ||||||||||||||||||||||| || |||| ||
Sbjct: 152 aaatctgcagaagtgccaaagggatatcttgcagtgtatgttggagataaaacgaagcgg 211
Query: 121 tttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgagtcaagct 180
||||| |||||| |||||||| |||||||||||||||||||||| || || ||||||
Sbjct: 212 tttgtgatccctatatcatacctgaaccaaccttcatttcaagagttactacatcaagcc 271
Query: 181 gaggacgagtttggatatgatcatcccatgggtggcctcacaattccttgcag 233
|| || || ||||||||||||||||| || ||||| ||||||||||| |||||
Sbjct: 272 gaagaagaatttggatatgatcatccaataggtggtctcacaattccatgcag 324
>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (88%)
Length = 764
Score = 137 bits (69), Expect = 4e-32
Identities = 120/137 (87%)
Strand = Plus / Plus
Query: 134 tatcatacttgaaccaaccttcatttcaagaattgctgagtcaagctgaggacgagtttg 193
||||||| ||||||||||| |||||||| || || |||||||||||||| |||||||
Sbjct: 523 tatcatatttgaaccaaccacaatttcaaggcttcctaagtcaagctgaggaagagtttg 582
Query: 194 gatatgatcatcccatgggtggcctcacaattccttgcagcgaagatgtcttccaacaga 253
||||||| |||| || |||||| ||||| ||||||||||| ||||||||||||||||| |
Sbjct: 583 gatatgaccatcacacgggtggtctcacgattccttgcagtgaagatgtcttccaacata 642
Query: 254 taactactcacttgaat 270
||||| |||||||||||
Sbjct: 643 taacttctcacttgaat 659
>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (90%)
Length = 491
Score = 105 bits (53), Expect = 1e-22
Identities = 119/141 (84%)
Strand = Plus / Plus
Query: 86 atcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatcatacttga 145
|||||||||| ||||||||||| ||| || | ||||||| || || |||||||||||||
Sbjct: 188 atcttgcagtctatgttggagatgaaatgaggcggtttgtgattccagtatcatacttga 247
Query: 146 accaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatatgatcatc 205
|||||||||| |||||||| || ||| |||||| || || || ||||||||||||||||
Sbjct: 248 accaaccttcttttcaagagttactgcatcaagcagaagaagaatttggatatgatcatc 307
Query: 206 ccatgggtggcctcacaattc 226
| | ||||| ||||||||||
Sbjct: 308 caacaggtggtctcacaattc 328
>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (91%)
Length = 523
Score = 89.7 bits (45), Expect = 8e-18
Identities = 102/121 (84%)
Strand = Plus / Plus
Query: 86 atcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatcatacttga 145
|||||||||| ||||||||||| ||| || | |||| || || || |||||||||||||
Sbjct: 187 atcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagtatcatacttga 246
Query: 146 accaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatatgatcatc 205
||||||||||||||||||| || || |||||| || || || ||||||||||||||||
Sbjct: 247 accaaccttcatttcaagagttactatatcaagccgaagaagaatttggatatgatcatc 306
Query: 206 c 206
|
Sbjct: 307 c 307
>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
n=1; Glycine max|Rep: Auxin-induced protein 15A -
Glycine max (Soybean), partial (90%)
Length = 494
Score = 71.9 bits (36), Expect = 2e-12
Identities = 129/160 (80%)
Strand = Plus / Plus
Query: 82 ggctatcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatcatac 141
|||||||||||||| ||||||| ||| || ||| ||||||| ||||| | ||||||
Sbjct: 179 ggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatttcatac 238
Query: 142 ttgaaccaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatatgat 201
|||| |||||||||||||||||| | | || |||||||| || | | |||||||||
Sbjct: 239 ctgaatcaaccttcatttcaagaactattaagccaagctgaagaaaaatacggatatgat 298
Query: 202 catcccatgggtggcctcacaattccttgcagcgaagatg 241
||||| ||||||| ||| |||||||||||| |||||||
Sbjct: 299 catccagtgggtggtctcgcaattccttgcaaagaagatg 338
>gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), complete
Length = 499
Score = 60.0 bits (30), Expect = 7e-09
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 133 gtatcatacttgaaccaaccttcatttcaagaattgctgagtcaagctgaggacgagttt 192
|||||| ||||||||||||||||| ||||||| || || |||||| || || ||||||
Sbjct: 236 gtatcacacttgaaccaaccttcacttcaagagttactacatcaagcagaagaagagttt 295
Query: 193 ggatatgatcatcc 206
|||||||| |||||
Sbjct: 296 ggatatgaccatcc 309