Miyakogusa Predicted Gene

Lj0g3v0040109.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0040109.1 Non Chatacterized Hit- tr|I3SH39|I3SH39_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=4
SV=1,100,0,Auxin_inducible,Auxin responsive SAUR protein; seg,NULL;
FAMILY NOT NAMED,NULL,CUFF.1893.1
         (279 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind...   553   e-157
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu...   157   4e-38
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu...   137   4e-32
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu...   105   1e-22
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu...    90   8e-18
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind...    72   2e-12
gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-ind...    60   7e-09

>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
           Glycine max|Rep: Auxin-induced protein 6B - Glycine max
           (Soybean), complete
          Length = 494

 Score =  553 bits (279), Expect = e-157
 Identities = 279/279 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgggttttcgtttacttgctattcgacgagcatcattcacttctagccaagcagcttca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 388 atgggttttcgtttacttgctattcgacgagcatcattcacttctagccaagcagcttca 329

                                                                       
Query: 61  aaatctgttaaagtttcgaagggctatcttgcagtgtatgttggagaagaacagaagagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 aaatctgttaaagtttcgaagggctatcttgcagtgtatgttggagaagaacagaagagg 269

                                                                       
Query: 121 tttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgagtcaagct 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268 tttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgagtcaagct 209

                                                                       
Query: 181 gaggacgagtttggatatgatcatcccatgggtggcctcacaattccttgcagcgaagat 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208 gaggacgagtttggatatgatcatcccatgggtggcctcacaattccttgcagcgaagat 149

                                                  
Query: 241 gtcttccaacagataactactcacttgaatgggctctaa 279
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 148 gtcttccaacagataactactcacttgaatgggctctaa 110


>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (80%)
          Length = 528

 Score =  157 bits (79), Expect = 4e-38
 Identities = 195/233 (83%), Gaps = 3/233 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggttttcgtttacttgctattcgacgagcatcattcacttctagccaagcagcttca 60
           |||||||| ||| ||||||||||| | || ||||| ||||||    ||||||||||||||
Sbjct: 95  atgggtttccgtatacttgctattaggcgggcatccttcactg---gccaagcagcttca 151

                                                                       
Query: 61  aaatctgttaaagtttcgaagggctatcttgcagtgtatgttggagaagaacagaagagg 120
           |||||||   ||||  | ||||| |||||||||||||||||||||||  ||  |||| ||
Sbjct: 152 aaatctgcagaagtgccaaagggatatcttgcagtgtatgttggagataaaacgaagcgg 211

                                                                       
Query: 121 tttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgagtcaagct 180
           ||||| |||||| |||||||| |||||||||||||||||||||| || ||   |||||| 
Sbjct: 212 tttgtgatccctatatcatacctgaaccaaccttcatttcaagagttactacatcaagcc 271

                                                                
Query: 181 gaggacgagtttggatatgatcatcccatgggtggcctcacaattccttgcag 233
           || || || ||||||||||||||||| || ||||| ||||||||||| |||||
Sbjct: 272 gaagaagaatttggatatgatcatccaataggtggtctcacaattccatgcag 324


>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (88%)
          Length = 764

 Score =  137 bits (69), Expect = 4e-32
 Identities = 120/137 (87%)
 Strand = Plus / Plus

                                                                       
Query: 134 tatcatacttgaaccaaccttcatttcaagaattgctgagtcaagctgaggacgagtttg 193
           ||||||| |||||||||||   ||||||||  || || |||||||||||||| |||||||
Sbjct: 523 tatcatatttgaaccaaccacaatttcaaggcttcctaagtcaagctgaggaagagtttg 582

                                                                       
Query: 194 gatatgatcatcccatgggtggcctcacaattccttgcagcgaagatgtcttccaacaga 253
           ||||||| |||| || |||||| ||||| ||||||||||| ||||||||||||||||| |
Sbjct: 583 gatatgaccatcacacgggtggtctcacgattccttgcagtgaagatgtcttccaacata 642

                            
Query: 254 taactactcacttgaat 270
           ||||| |||||||||||
Sbjct: 643 taacttctcacttgaat 659


>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (90%)
          Length = 491

 Score =  105 bits (53), Expect = 1e-22
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  atcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatcatacttga 145
           |||||||||| ||||||||||| |||  || | ||||||| || || |||||||||||||
Sbjct: 188 atcttgcagtctatgttggagatgaaatgaggcggtttgtgattccagtatcatacttga 247

                                                                       
Query: 146 accaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatatgatcatc 205
           |||||||||| |||||||| || |||  |||||| || || || ||||||||||||||||
Sbjct: 248 accaaccttcttttcaagagttactgcatcaagcagaagaagaatttggatatgatcatc 307

                                
Query: 206 ccatgggtggcctcacaattc 226
           | |  ||||| ||||||||||
Sbjct: 308 caacaggtggtctcacaattc 328


>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (91%)
          Length = 523

 Score = 89.7 bits (45), Expect = 8e-18
 Identities = 102/121 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  atcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatcatacttga 145
           |||||||||| ||||||||||| |||  || | |||| || || || |||||||||||||
Sbjct: 187 atcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagtatcatacttga 246

                                                                       
Query: 146 accaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatatgatcatc 205
           ||||||||||||||||||| || ||   |||||| || || || ||||||||||||||||
Sbjct: 247 accaaccttcatttcaagagttactatatcaagccgaagaagaatttggatatgatcatc 306

            
Query: 206 c 206
           |
Sbjct: 307 c 307


>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
           n=1; Glycine max|Rep: Auxin-induced protein 15A -
           Glycine max (Soybean), partial (90%)
          Length = 494

 Score = 71.9 bits (36), Expect = 2e-12
 Identities = 129/160 (80%)
 Strand = Plus / Plus

                                                                       
Query: 82  ggctatcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatcatac 141
           |||||||||||||| ||||||| |||  ||  |||  ||||||| |||||  | ||||||
Sbjct: 179 ggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatttcatac 238

                                                                       
Query: 142 ttgaaccaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatatgat 201
            |||| |||||||||||||||||| |  | || |||||||| ||  | |  |||||||||
Sbjct: 239 ctgaatcaaccttcatttcaagaactattaagccaagctgaagaaaaatacggatatgat 298

                                                   
Query: 202 catcccatgggtggcctcacaattccttgcagcgaagatg 241
           |||||  ||||||| ||| ||||||||||||  |||||||
Sbjct: 299 catccagtgggtggtctcgcaattccttgcaaagaagatg 338


>gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), complete
          Length = 499

 Score = 60.0 bits (30), Expect = 7e-09
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 133 gtatcatacttgaaccaaccttcatttcaagaattgctgagtcaagctgaggacgagttt 192
           |||||| ||||||||||||||||| ||||||| || ||   |||||| || || ||||||
Sbjct: 236 gtatcacacttgaaccaaccttcacttcaagagttactacatcaagcagaagaagagttt 295

                         
Query: 193 ggatatgatcatcc 206
           |||||||| |||||
Sbjct: 296 ggatatgaccatcc 309