Miyakogusa Predicted Gene
- Lj0g3v0039999.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0039999.1 Non Chatacterized Hit- tr|I1KER5|I1KER5_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,88.24,4e-19,FAMILY
NOT NAMED,NULL; Auxin_inducible,Auxin responsive SAUR
protein,CUFF.1819.1
(199 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind... 202 6e-52
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu... 141 2e-33
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind... 74 3e-13
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu... 66 8e-11
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu... 64 3e-10
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu... 62 1e-09
gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-ind... 50 5e-06
>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
Glycine max|Rep: Auxin-induced protein 6B - Glycine max
(Soybean), complete
Length = 494
Score = 202 bits (102), Expect = 6e-52
Identities = 144/158 (91%)
Strand = Plus / Minus
Query: 33 agcttcaaaatctgttaaagtgccaaagggctatcttgcagtgtatgttggtgaaaaaca 92
||||||||||||||||||||| | |||||||||||||||||||||||||| ||| ||||
Sbjct: 335 agcttcaaaatctgttaaagtttcgaagggctatcttgcagtgtatgttggagaagaaca 276
Query: 93 aaagcggtttgtgatccctatatcatacttgaaccaaccttcatttcaagacttgttgag 152
||| ||||||| |||||| ||||||||||||||||||||||||||||||| ||| ||||
Sbjct: 275 gaagaggtttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgag 216
Query: 153 taaagctgaggatgagtttgggtatgatcatcccatgg 190
| |||||||||| |||||||| ||||||||||||||||
Sbjct: 215 tcaagctgaggacgagtttggatatgatcatcccatgg 178
>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (80%)
Length = 528
Score = 141 bits (71), Expect = 2e-33
Identities = 101/111 (90%)
Strand = Plus / Plus
Query: 33 agcttcaaaatctgttaaagtgccaaagggctatcttgcagtgtatgttggtgaaaaaca 92
|||||||||||||| ||||||||||||| |||||||||||||||||||| || |||
Sbjct: 145 agcttcaaaatctgcagaagtgccaaagggatatcttgcagtgtatgttggagataaaac 204
Query: 93 aaagcggtttgtgatccctatatcatacttgaaccaaccttcatttcaaga 143
||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 205 gaagcggtttgtgatccctatatcatacctgaaccaaccttcatttcaaga 255
>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
n=1; Glycine max|Rep: Auxin-induced protein 15A -
Glycine max (Soybean), partial (90%)
Length = 494
Score = 73.8 bits (37), Expect = 3e-13
Identities = 76/89 (85%)
Strand = Plus / Plus
Query: 55 ccaaagggctatcttgcagtgtatgttggtgaaaaacaaaagcggtttgtgatccctata 114
||||| |||||||||||||| ||||||| || ||| || |||||||||||||| ||
Sbjct: 173 ccaaaaggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatt 232
Query: 115 tcatacttgaaccaaccttcatttcaaga 143
|||||| |||| |||||||||||||||||
Sbjct: 233 tcatacctgaatcaaccttcatttcaaga 261
>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (91%)
Length = 523
Score = 65.9 bits (33), Expect = 8e-11
Identities = 75/89 (84%)
Strand = Plus / Plus
Query: 55 ccaaagggctatcttgcagtgtatgttggtgaaaaacaaaagcggtttgtgatccctata 114
||||| ||| |||||||||| |||||||| || || | |||||| ||||| || ||
Sbjct: 177 ccaaaaggccatcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagta 236
Query: 115 tcatacttgaaccaaccttcatttcaaga 143
|||||||||||||||||||||||||||||
Sbjct: 237 tcatacttgaaccaaccttcatttcaaga 265
>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (90%)
Length = 491
Score = 63.9 bits (32), Expect = 3e-10
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 96 gcggtttgtgatccctatatcatacttgaaccaaccttcatttcaaga 143
|||||||||||| || |||||||||||||||||||||| ||||||||
Sbjct: 219 gcggtttgtgattccagtatcatacttgaaccaaccttcttttcaaga 266
>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (88%)
Length = 764
Score = 61.9 bits (31), Expect = 1e-09
Identities = 70/83 (84%)
Strand = Plus / Plus
Query: 102 tgtgatccctatatcatacttgaaccaaccttcatttcaagacttgttgagtaaagctga 161
||||||||| |||||||| ||||||||||| |||||||| ||| | ||| |||||||
Sbjct: 512 tgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaagctga 571
Query: 162 ggatgagtttgggtatgatcatc 184
||| |||||||| ||||| ||||
Sbjct: 572 ggaagagtttggatatgaccatc 594
>gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), complete
Length = 499
Score = 50.1 bits (25), Expect = 5e-06
Identities = 73/89 (82%)
Strand = Plus / Plus
Query: 55 ccaaagggctatcttgcagtgtatgttggtgaaaaacaaaagcggtttgtgatccctata 114
||||| ||||| |||||||| |||||||| || ||| | ||||| ||||| || ||
Sbjct: 179 ccaaaaggctaccttgcagtctatgttggagataaaatgagacggttcgtgattcccgta 238
Query: 115 tcatacttgaaccaaccttcatttcaaga 143
||| ||||||||||||||||| |||||||
Sbjct: 239 tcacacttgaaccaaccttcacttcaaga 267