Miyakogusa Predicted Gene

Lj0g3v0039999.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0039999.1 Non Chatacterized Hit- tr|I1KER5|I1KER5_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,88.24,4e-19,FAMILY
NOT NAMED,NULL; Auxin_inducible,Auxin responsive SAUR
protein,CUFF.1819.1
         (199 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind...   202   6e-52
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu...   141   2e-33
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind...    74   3e-13
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu...    66   8e-11
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu...    64   3e-10
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu...    62   1e-09
gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-ind...    50   5e-06

>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
           Glycine max|Rep: Auxin-induced protein 6B - Glycine max
           (Soybean), complete
          Length = 494

 Score =  202 bits (102), Expect = 6e-52
 Identities = 144/158 (91%)
 Strand = Plus / Minus

                                                                       
Query: 33  agcttcaaaatctgttaaagtgccaaagggctatcttgcagtgtatgttggtgaaaaaca 92
           |||||||||||||||||||||  | |||||||||||||||||||||||||| ||| ||||
Sbjct: 335 agcttcaaaatctgttaaagtttcgaagggctatcttgcagtgtatgttggagaagaaca 276

                                                                       
Query: 93  aaagcggtttgtgatccctatatcatacttgaaccaaccttcatttcaagacttgttgag 152
            ||| ||||||| |||||| ||||||||||||||||||||||||||||||| ||| ||||
Sbjct: 275 gaagaggtttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgag 216

                                                 
Query: 153 taaagctgaggatgagtttgggtatgatcatcccatgg 190
           | |||||||||| |||||||| ||||||||||||||||
Sbjct: 215 tcaagctgaggacgagtttggatatgatcatcccatgg 178


>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (80%)
          Length = 528

 Score =  141 bits (71), Expect = 2e-33
 Identities = 101/111 (90%)
 Strand = Plus / Plus

                                                                       
Query: 33  agcttcaaaatctgttaaagtgccaaagggctatcttgcagtgtatgttggtgaaaaaca 92
           ||||||||||||||   ||||||||||||| |||||||||||||||||||| || |||  
Sbjct: 145 agcttcaaaatctgcagaagtgccaaagggatatcttgcagtgtatgttggagataaaac 204

                                                              
Query: 93  aaagcggtttgtgatccctatatcatacttgaaccaaccttcatttcaaga 143
            ||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 205 gaagcggtttgtgatccctatatcatacctgaaccaaccttcatttcaaga 255


>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
           n=1; Glycine max|Rep: Auxin-induced protein 15A -
           Glycine max (Soybean), partial (90%)
          Length = 494

 Score = 73.8 bits (37), Expect = 3e-13
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                       
Query: 55  ccaaagggctatcttgcagtgtatgttggtgaaaaacaaaagcggtttgtgatccctata 114
           ||||| |||||||||||||| |||||||  || |||   || |||||||||||||| || 
Sbjct: 173 ccaaaaggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatt 232

                                        
Query: 115 tcatacttgaaccaaccttcatttcaaga 143
           |||||| |||| |||||||||||||||||
Sbjct: 233 tcatacctgaatcaaccttcatttcaaga 261


>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (91%)
          Length = 523

 Score = 65.9 bits (33), Expect = 8e-11
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 55  ccaaagggctatcttgcagtgtatgttggtgaaaaacaaaagcggtttgtgatccctata 114
           ||||| ||| |||||||||| |||||||| ||  ||   | |||||| ||||| ||  ||
Sbjct: 177 ccaaaaggccatcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagta 236

                                        
Query: 115 tcatacttgaaccaaccttcatttcaaga 143
           |||||||||||||||||||||||||||||
Sbjct: 237 tcatacttgaaccaaccttcatttcaaga 265


>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (90%)
          Length = 491

 Score = 63.9 bits (32), Expect = 3e-10
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 96  gcggtttgtgatccctatatcatacttgaaccaaccttcatttcaaga 143
           |||||||||||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 219 gcggtttgtgattccagtatcatacttgaaccaaccttcttttcaaga 266


>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (88%)
          Length = 764

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 102 tgtgatccctatatcatacttgaaccaaccttcatttcaagacttgttgagtaaagctga 161
           ||||||||| |||||||| |||||||||||   |||||||| |||  | ||| |||||||
Sbjct: 512 tgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaagctga 571

                                  
Query: 162 ggatgagtttgggtatgatcatc 184
           ||| |||||||| ||||| ||||
Sbjct: 572 ggaagagtttggatatgaccatc 594


>gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), complete
          Length = 499

 Score = 50.1 bits (25), Expect = 5e-06
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 55  ccaaagggctatcttgcagtgtatgttggtgaaaaacaaaagcggtttgtgatccctata 114
           ||||| ||||| |||||||| |||||||| || |||   |  ||||| ||||| ||  ||
Sbjct: 179 ccaaaaggctaccttgcagtctatgttggagataaaatgagacggttcgtgattcccgta 238

                                        
Query: 115 tcatacttgaaccaaccttcatttcaaga 143
           ||| ||||||||||||||||| |||||||
Sbjct: 239 tcacacttgaaccaaccttcacttcaaga 267