Miyakogusa Predicted Gene

Lj0g3v0038729.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0038729.2 Non Chatacterized Hit- tr|I1N5D0|I1N5D0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.50832
PE,91.39,0,Riboflavin synthase domain-like,Riboflavin synthase-like
beta-barrel; FAD_binding_1,FAD-binding, typ,CUFF.1743.2
         (462 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO039655 similar to UniRef100_A2Q1Q9 Cluster: Flavoprot...   143   1e-33

>gnl|LJGI|GO039655 similar to UniRef100_A2Q1Q9 Cluster: Flavoprotein pyridine
           nucleotide cytochrome reductase; n=1; Medicago
           truncatula|Rep: Flavoprotein pyridine nucleotide
           cytochrome reductase - Medicago truncatula (Barrel
           medic), partial (61%)
          Length = 867

 Score =  143 bits (72), Expect = 1e-33
 Identities = 85/88 (96%), Gaps = 1/88 (1%)
 Strand = Plus / Minus

                                                                       
Query: 63  aacagctgaacatgaaagggaaagacttaagtattttgcttcagctgaaggaagagatga 122
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 867 aacagctgaacatgaaagggaaagacttaagtattt-gcttcagctgaaggaagagatga 809

                                       
Query: 123 catgtatcaatacaaccagaaggaaagg 150
           |||||||||||||||||| || ||||||
Sbjct: 808 catgtatcaatacaaccaaaaagaaagg 781



 Score =  113 bits (57), Expect = 1e-24
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                       
Query: 402 gttcctcaaaggttcccttccaacaccatcaccatcacttcccctcatactcgttggacc 461
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 775 gttccccaaaggttcccttccaacaccatcaccatcacttcccctcatactcgttggacc 716

            
Query: 462 a 462
           |
Sbjct: 715 a 715