Miyakogusa Predicted Gene

Lj0g3v0038689.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0038689.1 NODE_84955_length_432_cov_13.842592.path2.1
         (463 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BI417964                                                      64   8e-10
gnl|LJGI|TC81314 similar to UniRef100_Q0JQ75 Cluster: Os01g01781...    64   8e-10
gnl|LJGI|TC79898 homologue to UniRef100_A8YAX2 Cluster: Genome s...    64   8e-10
gnl|LJGI|TC76768                                                       64   8e-10
gnl|LJGI|TC73793 weakly similar to UniRef100_Q4RQ54 Cluster: Chr...    64   8e-10
gnl|LJGI|TC72630 weakly similar to UniRef100_A7DTG3 Cluster: SER...    64   8e-10
gnl|LJGI|TC68986                                                       56   2e-07

>gnl|LJGI|BI417964 
          Length = 433

 Score = 63.9 bits (32), Expect = 8e-10
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 1   atgagtcatcgccattatcttcacgaccatct 32
           ||||||||||||||||||||||||||||||||
Sbjct: 247 atgagtcatcgccattatcttcacgaccatct 216


>gnl|LJGI|TC81314 similar to UniRef100_Q0JQ75 Cluster: Os01g0178100 protein; n=1;
           Oryza sativa Japonica Group|Rep: Os01g0178100 protein -
           Oryza sativa subsp. japonica (Rice), partial (4%)
          Length = 360

 Score = 63.9 bits (32), Expect = 8e-10
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 1   atgagtcatcgccattatcttcacgaccatct 32
           ||||||||||||||||||||||||||||||||
Sbjct: 100 atgagtcatcgccattatcttcacgaccatct 69


>gnl|LJGI|TC79898 homologue to UniRef100_A8YAX2 Cluster: Genome sequencing data,
           contig C262; n=1; Microcystis aeruginosa PCC 7806|Rep:
           Genome sequencing data, contig C262 - Microcystis
           aeruginosa PCC 7806, partial (10%)
          Length = 547

 Score = 63.9 bits (32), Expect = 8e-10
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 1   atgagtcatcgccattatcttcacgaccatct 32
           ||||||||||||||||||||||||||||||||
Sbjct: 293 atgagtcatcgccattatcttcacgaccatct 262


>gnl|LJGI|TC76768 
          Length = 560

 Score = 63.9 bits (32), Expect = 8e-10
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 1   atgagtcatcgccattatcttcacgaccatct 32
           ||||||||||||||||||||||||||||||||
Sbjct: 292 atgagtcatcgccattatcttcacgaccatct 261


>gnl|LJGI|TC73793 weakly similar to UniRef100_Q4RQ54 Cluster: Chromosome 17
           SCAF15006, whole genome shotgun sequence; n=1; Tetraodon
           nigroviridis|Rep: Chromosome 17 SCAF15006, whole genome
           shotgun sequence - Tetraodon nigroviridis (Green
           puffer), partial (3%)
          Length = 499

 Score = 63.9 bits (32), Expect = 8e-10
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 1   atgagtcatcgccattatcttcacgaccatct 32
           ||||||||||||||||||||||||||||||||
Sbjct: 277 atgagtcatcgccattatcttcacgaccatct 246


>gnl|LJGI|TC72630 weakly similar to UniRef100_A7DTG3 Cluster: SERTA domain-containing
           protein 4; n=1; Mus musculus|Rep: SERTA
           domain-containing protein 4 - Mus musculus (Mouse),
           partial (10%)
          Length = 484

 Score = 63.9 bits (32), Expect = 8e-10
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 1   atgagtcatcgccattatcttcacgaccatct 32
           ||||||||||||||||||||||||||||||||
Sbjct: 248 atgagtcatcgccattatcttcacgaccatct 217


>gnl|LJGI|TC68986 
          Length = 533

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 5   gtcatcgccattatcttcacgaccatct 32
           ||||||||||||||||||||||||||||
Sbjct: 278 gtcatcgccattatcttcacgaccatct 251