Miyakogusa Predicted Gene

Lj0g3v0037729.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0037729.1 Non Chatacterized Hit- tr|G7ZZ86|G7ZZ86_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,45.16,0.0000003,coiled-coil,NULL; seg,NULL,CUFF.1694.1
         (2715 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL...    58   3e-07

>gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL074Wp; n=1;
           Eremothecium gossypii|Rep: ACL074Wp - Ashbya gossypii
           (Yeast) (Eremothecium gossypii), partial (8%)
          Length = 691

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 34  cgaaatccgagagcaacgtggtgggattttgtgattgctttgctgagagaatttgaacca 93
           ||||||| ||| ||||  ||||||||||||||||| || |||||||| ||||| ||||||
Sbjct: 551 cgaaatcagagggcaaaatggtgggattttgtgatagcattgctgagggaattcgaacca 492

                    
Query: 94  aactcggaa 102
            | ||||||
Sbjct: 491 gaatcggaa 483