Miyakogusa Predicted Gene

Lj0g3v0033889.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0033889.1 NODE_96886_length_1178_cov_12.750424.path2.1
         (877 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71633 similar to UniRef100_Q6V9R8 Cluster: Anti-Mulle...    74   2e-12
gnl|LJGI|TC61666 similar to UniRef100_Q7SCZ7 Cluster: WASP-inter...    56   4e-07

>gnl|LJGI|TC71633 similar to UniRef100_Q6V9R8 Cluster: Anti-Mullerian hormone; n=1;
            Macropus eugenii|Rep: Anti-Mullerian hormone - Macropus
            eugenii (Tammar wallaby), partial (3%)
          Length = 1286

 Score = 73.8 bits (37), Expect = 2e-12
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                        
Query: 528  ctcagaagtcaaatcttcctctacttctgatggttgctcacccaccgtagcgtatctttc 587
            ||||||||| || |||||| || | |||||||||||||||||||| |||||||  || ||
Sbjct: 1093 ctcagaagttaagtcttccactgcatctgatggttgctcacccactgtagcgtgcctctc 1152

                             
Query: 588  ttcttccgccatcgtct 604
            |||||||||| ||||||
Sbjct: 1153 ttcttccgccgtcgtct 1169


>gnl|LJGI|TC61666 similar to UniRef100_Q7SCZ7 Cluster: WASP-interacting protein-like
           protein vrp1p; n=1; Neurospora crassa|Rep:
           WASP-interacting protein-like protein vrp1p - Neurospora
           crassa, partial (5%)
          Length = 822

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 627 cgctgccgctgttcgccccgcttcgattgcag 658
           |||||||||||||||| |||||||||||||||
Sbjct: 454 cgctgccgctgttcgctccgcttcgattgcag 485