Miyakogusa Predicted Gene

Lj0g3v0024109.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0024109.2 tr|K2K9F5|K2K9F5_9GAMM TonB-dependent siderophore
receptor OS=Gallaecimonas xiamenensis 3-C-1 PE=4 S,28.26,3.3,
,CUFF.1366.2
         (417 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72653 homologue to UniRef100_Q8HYZ5 Cluster: Alkaline...   317   3e-86

>gnl|LJGI|TC72653 homologue to UniRef100_Q8HYZ5 Cluster: Alkaline phosphatase; n=1;
           Sus scrofa|Rep: Alkaline phosphatase - Sus scrofa (Pig),
           partial (6%)
          Length = 494

 Score =  317 bits (160), Expect = 3e-86
 Identities = 163/164 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgacgattgaaaaccacctcgtgttgtttgctcccattgcaacggtaatagcagctaga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 331 atgacgattgaaaaccacctcgtgttgtttgctcccattgcaacggtaatagcagctaga 390

                                                                       
Query: 61  cgaagcagaagcacatcttccccctgtgactgcaagcttcaccgagggagcagaaggttt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391 cgaagcagaagcacatcttccccctgtgactgcaagcttcaccgagggagcagaaggttt 450

                                                       
Query: 121 cggtgggacacaatgagtggcgtgttcaagccttcaagggatat 164
           |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 451 cggtgggacacaatgagtagcgtgttcaagccttcaagggatat 494