Miyakogusa Predicted Gene

Lj0g3v0014479.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0014479.1 CUFF.775.1
         (342 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58604 similar to UniRef100_P09694 Cluster: Uncharacte...   266   8e-71

>gnl|LJGI|TC58604 similar to UniRef100_P09694 Cluster: Uncharacterized protein IRL4;
           n=1; Human herpesvirus 5 strain AD169|Rep:
           Uncharacterized protein IRL4 - Human cytomegalovirus
           (strain AD169) (HHV-5) (Human herpesvirus 5), partial
           (12%)
          Length = 1221

 Score =  266 bits (134), Expect = 8e-71
 Identities = 163/172 (94%), Gaps = 3/172 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggtatcagagctccaatggagctcaccgccacttccgccgccgc---cgtcgccgagt 57
           |||||||||||||||||||||||||||||||| |||||||||||||   |||||||||||
Sbjct: 428 atggtatcagagctccaatggagctcaccgcctcttccgccgccgctgccgtcgccgagt 487

                                                                       
Query: 58  tacgagcgcttccttcgacctgctcgccgtggcttcaagcgctgccgccgcagcaccact 117
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 488 tacgagcgcttcctccgacctgctcgacgtggcttcaagcgctgccgccgcagcaccact 547

                                                               
Query: 118 gcgagattatcttccttcactttctctgatttgatcgctgattttggagaca 169
           ||||||||||||||||||| ||||||||||||| || |||||||||||||||
Sbjct: 548 gcgagattatcttccttcaatttctctgatttggtcactgattttggagaca 599



 Score =  174 bits (88), Expect = 2e-43
 Identities = 106/112 (94%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttcatcgttctctgattcgatggtcatggtttctgattctctaatggtgcaagaatcaat 290
           ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
Sbjct: 622 ttcatcgttctctgattcgatggtcatggcttctgattctctcatggtgcaagaatcatt 681

                                                               
Query: 291 cgtgaaggttgaagatgaggattctatcttgcatcctccagttcctccttcc 342
           ||||||||||||||||||||||||| |||||||| |||||||||||| ||||
Sbjct: 682 cgtgaaggttgaagatgaggattctgtcttgcatgctccagttcctctttcc 733