Miyakogusa Predicted Gene

Lj0g3v0013779.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0013779.1 Non Chatacterized Hit- tr|I3S6Y1|I3S6Y1_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=4
SV=1,100,0.000000000000009,no
description,NULL,NODE_41960_length_159_cov_729.698120.path2.1
         (123 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65429 homologue to UniRef100_A2TKE7 Cluster: Ubiquiti...   244   1e-64
gnl|LJGI|TC64556 UniRef100_A2TKE7 Cluster: Ubiquitin-like protei...   186   2e-47
gnl|LJGI|GO015983 homologue to UniRef100_A2TKE7 Cluster: Ubiquit...    64   2e-10
gnl|LJGI|TC69082 homologue to UniRef100_A2TKE7 Cluster: Ubiquiti...    64   2e-10
gnl|LJGI|TC66905 homologue to UniRef100_A2TKE7 Cluster: Ubiquiti...    64   2e-10
gnl|LJGI|FS347344 homologue to UniRef100_A2TKE7 Cluster: Ubiquit...    56   5e-08

>gnl|LJGI|TC65429 homologue to UniRef100_A2TKE7 Cluster: Ubiquitin-like protein; n=1;
           Pisum sativum|Rep: Ubiquitin-like protein - Pisum
           sativum (Garden pea), partial (97%)
          Length = 652

 Score =  244 bits (123), Expect = 1e-64
 Identities = 123/123 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtcatccggcggcggcgttaccaacaacgaggaagacaagaagcccaccgatcagggc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 85  atgtcatccggcggcggcgttaccaacaacgaggaagacaagaagcccaccgatcagggc 144

                                                                       
Query: 61  ggcgcacacatcaatctcaaggtcaagggccaggatgggaatgaagttttcttcaggatc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 145 ggcgcacacatcaatctcaaggtcaagggccaggatgggaatgaagttttcttcaggatc 204

              
Query: 121 aag 123
           |||
Sbjct: 205 aag 207


>gnl|LJGI|TC64556 UniRef100_A2TKE7 Cluster: Ubiquitin-like protein; n=1; Pisum
           sativum|Rep: Ubiquitin-like protein - Pisum sativum
           (Garden pea), partial (21%)
          Length = 739

 Score =  186 bits (94), Expect = 2e-47
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtcatccggcggcggcgttaccaacaacgaggaagacaagaagcccaccgatcagggc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 84  atgtcatccggcggcggcgttaccaacaacgaggaagacaagaagcccaccgatcagggc 143

                                             
Query: 61  ggcgcacacatcaatctcaaggtcaagggccagg 94
           ||||||||||||||||||||||||||||||||||
Sbjct: 144 ggcgcacacatcaatctcaaggtcaagggccagg 177


>gnl|LJGI|GO015983 homologue to UniRef100_A2TKE7 Cluster: Ubiquitin-like protein; n=1;
           Pisum sativum|Rep: Ubiquitin-like protein - Pisum
           sativum (Garden pea), partial (76%)
          Length = 855

 Score = 63.9 bits (32), Expect = 2e-10
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 92  aggatgggaatgaagttttcttcaggatcaag 123
           ||||||||||||||||||||||||||||||||
Sbjct: 503 aggatgggaatgaagttttcttcaggatcaag 472


>gnl|LJGI|TC69082 homologue to UniRef100_A2TKE7 Cluster: Ubiquitin-like protein; n=1;
           Pisum sativum|Rep: Ubiquitin-like protein - Pisum
           sativum (Garden pea), partial (82%)
          Length = 587

 Score = 63.9 bits (32), Expect = 2e-10
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 67  cacatcaatctcaaggtcaagggccaggatgggaatgaagttttcttcaggatcaa 122
           ||||||||| | ||||| || ||||||||||| |||||||| ||||||||||||||
Sbjct: 139 cacatcaatttgaaggttaaaggccaggatggcaatgaagtattcttcaggatcaa 194


>gnl|LJGI|TC66905 homologue to UniRef100_A2TKE7 Cluster: Ubiquitin-like protein; n=1;
           Pisum sativum|Rep: Ubiquitin-like protein - Pisum
           sativum (Garden pea), partial (82%)
          Length = 653

 Score = 63.9 bits (32), Expect = 2e-10
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 67  cacatcaatctcaaggtcaagggccaggatgggaatgaagttttcttcaggatcaa 122
           ||||||||| | ||||| || ||||||||||| |||||||| ||||||||||||||
Sbjct: 144 cacatcaatttgaaggttaaaggccaggatggcaatgaagtattcttcaggatcaa 199


>gnl|LJGI|FS347344 homologue to UniRef100_A2TKE7 Cluster: Ubiquitin-like protein; n=1;
           Pisum sativum|Rep: Ubiquitin-like protein - Pisum
           sativum (Garden pea), partial (76%)
          Length = 665

 Score = 56.0 bits (28), Expect = 5e-08
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 92  aggatgggaatgaagttttcttcaggatcaag 123
           ||||||||||||||||||| ||||||||||||
Sbjct: 405 aggatgggaatgaagtttttttcaggatcaag 374