Miyakogusa Predicted Gene
- Lj0g3v0013429.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0013429.1 tr|Q71FJ3|Q71FJ3_MELAB Expansin OS=Melilotus alba
GN=Exp1 PE=2 SV=1,96.49,1e-23,EXPANSIN_CBD,Pollen allergen/expansin,
C-terminal; no description,Pollen allergen/expansin,
C-termin,CUFF.700.1
(174 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC58153 homologue to UniRef100_A7NYZ1 Cluster: Chromoso... 337 1e-92
gnl|LJGI|AV772882 similar to UniRef100_Q9LLB3 Cluster: Expansin ... 218 8e-57
gnl|LJGI|TC68635 homologue to UniRef100_Q2V728 Cluster: Expansin... 86 8e-17
gnl|LJGI|TC73866 similar to UniRef100_A7NYZ1 Cluster: Chromosome... 64 3e-10
gnl|LJGI|TC77104 homologue to UniRef100_Q06BI7 Cluster: Ripening... 58 2e-08
gnl|LJGI|TC68615 similar to UniRef100_A4GWU6 Cluster: Expansin; ... 52 1e-06
>gnl|LJGI|TC58153 homologue to UniRef100_A7NYZ1 Cluster: Chromosome chr6 scaffold_3,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr6 scaffold_3, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (93%)
Length = 1128
Score = 337 bits (170), Expect = 1e-92
Identities = 173/174 (99%)
Strand = Plus / Plus
Query: 1 atgagtatgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 662 atgagtatgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcag 721
Query: 61 tcactgtcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgtt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 722 tcactgtcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgtt 781
Query: 121 ccatccaattggcaatttggacaaactttcactgggaagaatttcagggtctag 174
|||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 782 ccatcccattggcaatttggacaaactttcactgggaagaatttcagggtctag 835
>gnl|LJGI|AV772882 similar to UniRef100_Q9LLB3 Cluster: Expansin 1; n=1; Zinnia
elegans|Rep: Expansin 1 - Zinnia elegans (Zinnia),
partial (21%)
Length = 488
Score = 218 bits (110), Expect = 8e-57
Identities = 125/130 (96%)
Strand = Plus / Minus
Query: 45 tgttctggttggtcagtcactgtcattcagggtgacagccagtgaccgacgcacttccac 104
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 488 tgttctggttggtcagtcactgtcattcagggtgacagccactgaccgacgcacttccac 429
Query: 105 atcattgaacattgttccatccaattggcaatttggacaaactttcactgggaagaattt 164
|||| ||||||||||||||||| |||| | ||||||||||||||||||||||||||||||
Sbjct: 428 atcaatgaacattgttccatcccattgcccatttggacaaactttcactgggaagaattt 369
Query: 165 cagggtctag 174
||||||||||
Sbjct: 368 cagggtctag 359
>gnl|LJGI|TC68635 homologue to UniRef100_Q2V728 Cluster: Expansin 5; n=1; Cucumis
sativus|Rep: Expansin 5 - Cucumis sativus (Cucumber),
partial (95%)
Length = 815
Score = 85.7 bits (43), Expect = 8e-17
Identities = 136/167 (81%)
Strand = Plus / Plus
Query: 7 atgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcagtcactg 66
||||| || ||||||||||| || |||||||| ||| | ||| |||| || ||| | |||
Sbjct: 151 atgagtaggaactggggtcaaaattggcagtccaacgccgttttggtgggccaggccctg 210
Query: 67 tcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgttccatcc 126
|||||| | || || ||||| ||||| ||||| ||||| || | |||||||| ||| |
Sbjct: 211 tcattccgtgtcaccgccagcgaccgtcgcacgtccacctcctggaacattgctccggca 270
Query: 127 aattggcaatttggacaaactttcactgggaagaatttcagggtcta 173
|||||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 271 cattggcaattcggtcaaactttcaccgggaagaatttccgggtcta 317
>gnl|LJGI|TC73866 similar to UniRef100_A7NYZ1 Cluster: Chromosome chr6 scaffold_3,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr6 scaffold_3, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (96%)
Length = 993
Score = 63.9 bits (32), Expect = 3e-10
Identities = 135/168 (80%), Gaps = 1/168 (0%)
Strand = Plus / Plus
Query: 7 atgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcagtcactg 66
||||| || |||||||||| || ||||||||| || | ||| |||| || ||| | |||
Sbjct: 746 atgagtaggaactggggtcgaaattggcagtcacacgccgttttggtgggccaggccctg 805
Query: 67 tcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgttccatcc 126
|||||| | || || ||||| ||||| ||||| ||||| || | |||||||| ||| |
Sbjct: 806 tcattccgtgtcaccgccagcgaccgtcgcacgtccacctcctggaacattgctccggca 865
Query: 127 aattggcaatttggacaaactttcactgggaaga-atttcagggtcta 173
|||||||||| || ||||||||||| ||||||| ||||| |||||||
Sbjct: 866 cattggcaattcggtcaaactttcaccgggaagagatttccgggtcta 913
>gnl|LJGI|TC77104 homologue to UniRef100_Q06BI7 Cluster: Ripening-related expansin;
n=1; Cucumis melo|Rep: Ripening-related expansin -
Cucumis melo (Muskmelon), partial (78%)
Length = 606
Score = 58.0 bits (29), Expect = 2e-08
Identities = 131/165 (79%)
Strand = Plus / Plus
Query: 1 atgagtatgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcag 60
||||||||||| | |||||||| || || ||||| || ||||||||| |||| || |||
Sbjct: 440 atgagtatgagtcgtaactgggggcaaaattggcaatccaactctgttttggtgggccag 499
Query: 61 tcactgtcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgtt 120
| || || || ||||| || | ||||||||||||||| || || |||| |||| | |
Sbjct: 500 accctctcctttagggtcaccggcagtgaccgacgcacctcaacgtcatggaacgtggca 559
Query: 121 ccatccaattggcaatttggacaaactttcactgggaagaatttc 165
||| | |||||||| || |||||||| ||||| || |||||||||
Sbjct: 560 ccagctaattggcagttcggacaaaccttcaccggaaagaatttc 604
>gnl|LJGI|TC68615 similar to UniRef100_A4GWU6 Cluster: Expansin; n=1; Litchi
chinensis|Rep: Expansin - Litchi chinensis (Lychee),
partial (95%)
Length = 1302
Score = 52.0 bits (26), Expect = 1e-06
Identities = 131/166 (78%)
Strand = Plus / Plus
Query: 7 atgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcagtcactg 66
|||||| |||||||||| || || ||||| || ||||||| | | || || ||| |||||
Sbjct: 680 atgagccgaaactgggggcaaaattggcaatccaactctgatttagtgggccaggcactg 739
Query: 67 tcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgttccatcc 126
|| |||||||| || | |||||| ||||||| || || || | |||| | | |||||
Sbjct: 740 tctttcagggtcacgggtagtgacagacgcacctcaacctcgtggaacgtggcaccatct 799
Query: 127 aattggcaatttggacaaactttcactgggaagaatttcagggtct 172
||||||| ||||| ||||| ||||| || ||||||||||| ||||
Sbjct: 800 cattggcagtttggtcaaaccttcacgggaaagaatttcagagtct 845