Miyakogusa Predicted Gene

Lj0g3v0013429.1
Show Alignment: 
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0013429.1 tr|Q71FJ3|Q71FJ3_MELAB Expansin OS=Melilotus alba
GN=Exp1 PE=2 SV=1,96.49,1e-23,EXPANSIN_CBD,Pollen allergen/expansin,
C-terminal; no description,Pollen allergen/expansin,
C-termin,CUFF.700.1
         (174 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58153 homologue to UniRef100_A7NYZ1 Cluster: Chromoso...   337   1e-92
gnl|LJGI|AV772882 similar to UniRef100_Q9LLB3 Cluster: Expansin ...   218   8e-57
gnl|LJGI|TC68635 homologue to UniRef100_Q2V728 Cluster: Expansin...    86   8e-17
gnl|LJGI|TC73866 similar to UniRef100_A7NYZ1 Cluster: Chromosome...    64   3e-10
gnl|LJGI|TC77104 homologue to UniRef100_Q06BI7 Cluster: Ripening...    58   2e-08
gnl|LJGI|TC68615 similar to UniRef100_A4GWU6 Cluster: Expansin; ...    52   1e-06

>gnl|LJGI|TC58153 homologue to UniRef100_A7NYZ1 Cluster: Chromosome chr6 scaffold_3,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr6 scaffold_3, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (93%)
          Length = 1128

 Score =  337 bits (170), Expect = 1e-92
 Identities = 173/174 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagtatgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 662 atgagtatgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcag 721

                                                                       
Query: 61  tcactgtcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgtt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 722 tcactgtcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgtt 781

                                                                 
Query: 121 ccatccaattggcaatttggacaaactttcactgggaagaatttcagggtctag 174
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 782 ccatcccattggcaatttggacaaactttcactgggaagaatttcagggtctag 835


>gnl|LJGI|AV772882 similar to UniRef100_Q9LLB3 Cluster: Expansin 1; n=1; Zinnia
           elegans|Rep: Expansin 1 - Zinnia elegans (Zinnia),
           partial (21%)
          Length = 488

 Score =  218 bits (110), Expect = 8e-57
 Identities = 125/130 (96%)
 Strand = Plus / Minus

                                                                       
Query: 45  tgttctggttggtcagtcactgtcattcagggtgacagccagtgaccgacgcacttccac 104
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 488 tgttctggttggtcagtcactgtcattcagggtgacagccactgaccgacgcacttccac 429

                                                                       
Query: 105 atcattgaacattgttccatccaattggcaatttggacaaactttcactgggaagaattt 164
           |||| ||||||||||||||||| |||| | ||||||||||||||||||||||||||||||
Sbjct: 428 atcaatgaacattgttccatcccattgcccatttggacaaactttcactgggaagaattt 369

                     
Query: 165 cagggtctag 174
           ||||||||||
Sbjct: 368 cagggtctag 359


>gnl|LJGI|TC68635 homologue to UniRef100_Q2V728 Cluster: Expansin 5; n=1; Cucumis
           sativus|Rep: Expansin 5 - Cucumis sativus (Cucumber),
           partial (95%)
          Length = 815

 Score = 85.7 bits (43), Expect = 8e-17
 Identities = 136/167 (81%)
 Strand = Plus / Plus

                                                                       
Query: 7   atgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcagtcactg 66
           ||||| || ||||||||||| || |||||||| ||| | ||| |||| || ||| | |||
Sbjct: 151 atgagtaggaactggggtcaaaattggcagtccaacgccgttttggtgggccaggccctg 210

                                                                       
Query: 67  tcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgttccatcc 126
           |||||| | || || ||||| ||||| ||||| ||||| || | |||||||| |||  | 
Sbjct: 211 tcattccgtgtcaccgccagcgaccgtcgcacgtccacctcctggaacattgctccggca 270

                                                          
Query: 127 aattggcaatttggacaaactttcactgggaagaatttcagggtcta 173
            |||||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 271 cattggcaattcggtcaaactttcaccgggaagaatttccgggtcta 317


>gnl|LJGI|TC73866 similar to UniRef100_A7NYZ1 Cluster: Chromosome chr6 scaffold_3,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr6 scaffold_3, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (96%)
          Length = 993

 Score = 63.9 bits (32), Expect = 3e-10
 Identities = 135/168 (80%), Gaps = 1/168 (0%)
 Strand = Plus / Plus

                                                                       
Query: 7   atgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcagtcactg 66
           ||||| || ||||||||||  || ||||||||| || | ||| |||| || ||| | |||
Sbjct: 746 atgagtaggaactggggtcgaaattggcagtcacacgccgttttggtgggccaggccctg 805

                                                                       
Query: 67  tcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgttccatcc 126
           |||||| | || || ||||| ||||| ||||| ||||| || | |||||||| |||  | 
Sbjct: 806 tcattccgtgtcaccgccagcgaccgtcgcacgtccacctcctggaacattgctccggca 865

                                                           
Query: 127 aattggcaatttggacaaactttcactgggaaga-atttcagggtcta 173
            |||||||||| || ||||||||||| ||||||| ||||| |||||||
Sbjct: 866 cattggcaattcggtcaaactttcaccgggaagagatttccgggtcta 913


>gnl|LJGI|TC77104 homologue to UniRef100_Q06BI7 Cluster: Ripening-related expansin;
           n=1; Cucumis melo|Rep: Ripening-related expansin -
           Cucumis melo (Muskmelon), partial (78%)
          Length = 606

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 131/165 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagtatgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcag 60
           |||||||||||  | |||||||| || || ||||| || ||||||||| |||| || |||
Sbjct: 440 atgagtatgagtcgtaactgggggcaaaattggcaatccaactctgttttggtgggccag 499

                                                                       
Query: 61  tcactgtcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgtt 120
            | || || || ||||| || | ||||||||||||||| || || |||| |||| | |  
Sbjct: 500 accctctcctttagggtcaccggcagtgaccgacgcacctcaacgtcatggaacgtggca 559

                                                        
Query: 121 ccatccaattggcaatttggacaaactttcactgggaagaatttc 165
           ||| | |||||||| || |||||||| ||||| || |||||||||
Sbjct: 560 ccagctaattggcagttcggacaaaccttcaccggaaagaatttc 604


>gnl|LJGI|TC68615 similar to UniRef100_A4GWU6 Cluster: Expansin; n=1; Litchi
           chinensis|Rep: Expansin - Litchi chinensis (Lychee),
           partial (95%)
          Length = 1302

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 131/166 (78%)
 Strand = Plus / Plus

                                                                       
Query: 7   atgagcagaaactggggtcagaactggcagtcaaactctgttctggttggtcagtcactg 66
           |||||| |||||||||| || || ||||| || ||||||| | | || || ||| |||||
Sbjct: 680 atgagccgaaactgggggcaaaattggcaatccaactctgatttagtgggccaggcactg 739

                                                                       
Query: 67  tcattcagggtgacagccagtgaccgacgcacttccacatcattgaacattgttccatcc 126
           || |||||||| || |  |||||| ||||||| || || || | |||| | |  ||||| 
Sbjct: 740 tctttcagggtcacgggtagtgacagacgcacctcaacctcgtggaacgtggcaccatct 799

                                                         
Query: 127 aattggcaatttggacaaactttcactgggaagaatttcagggtct 172
            ||||||| ||||| ||||| ||||| || ||||||||||| ||||
Sbjct: 800 cattggcagtttggtcaaaccttcacgggaaagaatttcagagtct 845