Miyakogusa Predicted Gene
- Lj0g3v0012529.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0012529.1 Non Chatacterized Hit- tr|I1MZT4|I1MZT4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.20166
PE,87.85,0,Heme-dependent peroxidases,Haem peroxidase; peroxidase,Haem
peroxidase, plant/fungal/bacterial; no d,CUFF.641.1
(966 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59155 similar to UniRef100_P22195 Cluster: Cationic p... 88 1e-16
gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic p... 84 2e-15
gnl|LJGI|TC68836 similar to UniRef100_Q40372 Cluster: Peroxidase... 80 3e-14
gnl|LJGI|TC80421 similar to UniRef100_P22195 Cluster: Cationic p... 64 2e-09
gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase... 64 2e-09
gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic p... 62 7e-09
gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic ... 60 3e-08
gnl|LJGI|TC64303 similar to UniRef100_Q43854 Cluster: Peroxidase... 60 3e-08
gnl|LJGI|DC595608 similar to UniRef100_Q41324 Cluster: Cationic ... 58 1e-07
gnl|LJGI|TC75972 weakly similar to UniRef100_Q5JBR1 Cluster: Ani... 58 1e-07
gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase... 58 1e-07
gnl|LJGI|BW599977 similar to UniRef100_P22195 Cluster: Cationic ... 56 4e-07
gnl|LJGI|TC81109 similar to UniRef100_Q9XFL4 Cluster: Peroxidase... 56 4e-07
gnl|LJGI|TC76465 similar to UniRef100_Q40372 Cluster: Peroxidase... 56 4e-07
gnl|LJGI|TC57867 similar to UniRef100_Q9XFL4 Cluster: Peroxidase... 56 4e-07
>gnl|LJGI|TC59155 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 1 precursor - Arachis hypogaea (Peanut),
partial (96%)
Length = 1209
Score = 87.7 bits (44), Expect = 1e-16
Identities = 83/96 (86%)
Strand = Plus / Plus
Query: 190 ctccgtcttcatttccatgactgctttgttaatggatgtgatgcatcggttctattagat 249
|||||||||||||||||||| ||||||||| | || ||||||||||| | || || |||
Sbjct: 251 ctccgtcttcatttccatgattgctttgttcaaggttgtgatgcatcaatactgttggat 310
Query: 250 gacacttcgagtttcacgggagagaagacagctggt 285
||||| || |||||||| || |||||||||||||||
Sbjct: 311 gacacatctagtttcacaggtgagaagacagctggt 346
>gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (95%)
Length = 1291
Score = 83.8 bits (42), Expect = 2e-15
Identities = 96/114 (84%)
Strand = Plus / Plus
Query: 172 cgcatgggcgcgtccttactccgtcttcatttccatgactgctttgttaatggatgtgat 231
|||||||| || ||| | |||||||||||||||||||| ||||| || | |||||||||
Sbjct: 256 cgcatgggagcttccctgctccgtcttcatttccatgattgcttcgtccaaggatgtgat 315
Query: 232 gcatcggttctattagatgacacttcgagtttcacgggagagaagacagctggt 285
||||| | || || |||||||| |||| |||||| || |||||||||||||||
Sbjct: 316 gcatcaatactgttggatgacacatcgaatttcacaggtgagaagacagctggt 369
>gnl|LJGI|TC68836 similar to UniRef100_Q40372 Cluster: Peroxidase precursor; n=1;
Medicago truncatula|Rep: Peroxidase precursor - Medicago
truncatula (Barrel medic), partial (49%)
Length = 578
Score = 79.8 bits (40), Expect = 3e-14
Identities = 79/92 (85%)
Strand = Plus / Plus
Query: 166 gaacaccgcatgggcgcgtccttactccgtcttcatttccatgactgctttgttaatgga 225
||||| ||||| || || |||||||| ||| | ||||||||||||||||||||||| ||
Sbjct: 185 gaacaacgcattggagcatccttactacgtttgcatttccatgactgctttgttaacggt 244
Query: 226 tgtgatgcatcggttctattagatgacacttc 257
||||||| ||| ||||| |||||||||||||
Sbjct: 245 tgtgatggatcacttctactagatgacacttc 276
>gnl|LJGI|TC80421 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 1 precursor - Arachis hypogaea (Peanut),
partial (61%)
Length = 734
Score = 63.9 bits (32), Expect = 2e-09
Identities = 65/76 (85%)
Strand = Plus / Plus
Query: 161 ccaaagaacaccgcatgggcgcgtccttactccgtcttcatttccatgactgctttgtta 220
||||||| | ||||||||| || ||||| || || || ||||||||||| |||||||||
Sbjct: 229 ccaaagagccccgcatgggggcatccttgcttcgactccatttccatgattgctttgttc 288
Query: 221 atggatgtgatgcatc 236
| ||||||||||||||
Sbjct: 289 aaggatgtgatgcatc 304
>gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase 5; n=1; Phaseolus
vulgaris|Rep: Peroxidase 5 - Phaseolus vulgaris (Kidney
bean) (French bean), partial (93%)
Length = 1309
Score = 63.9 bits (32), Expect = 2e-09
Identities = 38/40 (95%)
Strand = Plus / Plus
Query: 193 cgtcttcatttccatgactgctttgttaatggatgtgatg 232
||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 248 cgtcttcattttcatgattgctttgttaatggatgtgatg 287
>gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 1 precursor - Arachis hypogaea (Peanut),
partial (81%)
Length = 896
Score = 61.9 bits (31), Expect = 7e-09
Identities = 73/87 (83%)
Strand = Plus / Plus
Query: 199 catttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacacttcg 258
||||||||||| ||||| || | |||||||||||||| | || || |||||||| |||
Sbjct: 2 catttccatgattgcttcgtccaaggatgtgatgcatcaatactgttggatgacacatcg 61
Query: 259 agtttcacgggagagaagacagctggt 285
| |||||| || |||||||||||||||
Sbjct: 62 aatttcacaggtgagaagacagctggt 88
>gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (43%)
Length = 562
Score = 60.0 bits (30), Expect = 3e-08
Identities = 54/62 (87%)
Strand = Plus / Plus
Query: 175 atgggcgcgtccttactccgtcttcatttccatgactgctttgttaatggatgtgatgca 234
||||| || ||||| |||||||||||||||||||| |||||||| | || |||||||||
Sbjct: 249 atgggtgcatccttgctccgtcttcatttccatgattgctttgtccaagggtgtgatgca 308
Query: 235 tc 236
||
Sbjct: 309 tc 310
>gnl|LJGI|TC64303 similar to UniRef100_Q43854 Cluster: Peroxidase precursor; n=1;
Vigna angularis|Rep: Peroxidase precursor - Phaseolus
angularis (Adzuki bean) (Vigna angularis), partial (85%)
Length = 1402
Score = 60.0 bits (30), Expect = 3e-08
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 193 cgtcttcatttccatgactgctttgttaatggatgtgatgcatcggttctattagatg 250
|||||||| |||||||||||||||||| | || ||||||||||| || ||||| ||||
Sbjct: 296 cgtcttcacttccatgactgctttgttcagggttgtgatgcatcagtactattggatg 353
>gnl|LJGI|DC595608 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (26%)
Length = 390
Score = 58.0 bits (29), Expect = 1e-07
Identities = 77/93 (82%)
Strand = Plus / Plus
Query: 190 ctccgtcttcatttccatgactgctttgttaatggatgtgatgcatcggttctattagat 249
|||||||| ||||||||||| || ||||| | |||||||||||||| | | || |||
Sbjct: 272 ctccgtctccatttccatgattgttttgtccaaggatgtgatgcatcaatattgttggat 331
Query: 250 gacacttcgagtttcacgggagagaagacagct 282
||||| |||| |||||| || ||||||||||||
Sbjct: 332 gacacatcgaatttcacaggtgagaagacagct 364
>gnl|LJGI|TC75972 weakly similar to UniRef100_Q5JBR1 Cluster: Anionic peroxidase
swpb3; n=1; Ipomoea batatas|Rep: Anionic peroxidase
swpb3 - Ipomoea batatas (Sweet potato) (Batate), partial
(92%)
Length = 995
Score = 58.0 bits (29), Expect = 1e-07
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 202 ttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacac 254
||||||||||||||||| || |||||||||||||| | ||||| ||||||||
Sbjct: 198 ttccatgactgctttgtaaacggatgtgatgcatcaatactattggatgacac 250
>gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase 71 precursor; n=1;
Arabidopsis thaliana|Rep: Peroxidase 71 precursor -
Arabidopsis thaliana (Mouse-ear cress), partial (65%)
Length = 1340
Score = 58.0 bits (29), Expect = 1e-07
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 370 tgtgcagatattgttgctgttgctgctcgtgattctgttgt 410
||||| |||||| ||||| ||||||||||||||||||||||
Sbjct: 445 tgtgctgatattcttgctcttgctgctcgtgattctgttgt 485
>gnl|LJGI|BW599977 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 1 precursor - Arachis hypogaea (Peanut),
partial (36%)
Length = 455
Score = 56.0 bits (28), Expect = 4e-07
Identities = 64/76 (84%)
Strand = Plus / Plus
Query: 161 ccaaagaacaccgcatgggcgcgtccttactccgtcttcatttccatgactgctttgtta 220
||||||| | ||||||||| || ||||| || | || ||||||||||| |||||||||
Sbjct: 200 ccaaagagccccgcatgggggcatccttgcttcaactccatttccatgattgctttgttc 259
Query: 221 atggatgtgatgcatc 236
| ||||||||||||||
Sbjct: 260 aaggatgtgatgcatc 275
>gnl|LJGI|TC81109 similar to UniRef100_Q9XFL4 Cluster: Peroxidase 3; n=1; Phaseolus
vulgaris|Rep: Peroxidase 3 - Phaseolus vulgaris (Kidney
bean) (French bean), partial (36%)
Length = 579
Score = 56.0 bits (28), Expect = 4e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 202 ttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacacttc 257
||||||||||||||||| ||||| ||||||| ||| || ||| | |||||||||||
Sbjct: 353 ttccatgactgctttgtcaatggttgtgatggatcagtactacttgatgacacttc 408
>gnl|LJGI|TC76465 similar to UniRef100_Q40372 Cluster: Peroxidase precursor; n=1;
Medicago truncatula|Rep: Peroxidase precursor - Medicago
truncatula (Barrel medic), partial (58%)
Length = 666
Score = 56.0 bits (28), Expect = 4e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 199 catttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacac 254
||||||||||| ||||| |||||||| ||||||| ||| ||||| ||||||||||
Sbjct: 236 catttccatgattgcttcgttaatggctgtgatggatcagttctgctagatgacac 291
>gnl|LJGI|TC57867 similar to UniRef100_Q9XFL4 Cluster: Peroxidase 3; n=1; Phaseolus
vulgaris|Rep: Peroxidase 3 - Phaseolus vulgaris (Kidney
bean) (French bean), partial (85%)
Length = 1329
Score = 56.0 bits (28), Expect = 4e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 202 ttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacacttc 257
||||||||||||||||| ||||| ||||||| ||| || ||| | |||||||||||
Sbjct: 256 ttccatgactgctttgtcaatggttgtgatggatcagtactacttgatgacacttc 311