Miyakogusa Predicted Gene

Lj0g3v0012529.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0012529.1 Non Chatacterized Hit- tr|I1MZT4|I1MZT4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.20166
PE,87.85,0,Heme-dependent peroxidases,Haem peroxidase; peroxidase,Haem
peroxidase, plant/fungal/bacterial; no d,CUFF.641.1
         (966 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59155 similar to UniRef100_P22195 Cluster: Cationic p...    88   1e-16
gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic p...    84   2e-15
gnl|LJGI|TC68836 similar to UniRef100_Q40372 Cluster: Peroxidase...    80   3e-14
gnl|LJGI|TC80421 similar to UniRef100_P22195 Cluster: Cationic p...    64   2e-09
gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase...    64   2e-09
gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic p...    62   7e-09
gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic ...    60   3e-08
gnl|LJGI|TC64303 similar to UniRef100_Q43854 Cluster: Peroxidase...    60   3e-08
gnl|LJGI|DC595608 similar to UniRef100_Q41324 Cluster: Cationic ...    58   1e-07
gnl|LJGI|TC75972 weakly similar to UniRef100_Q5JBR1 Cluster: Ani...    58   1e-07
gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase...    58   1e-07
gnl|LJGI|BW599977 similar to UniRef100_P22195 Cluster: Cationic ...    56   4e-07
gnl|LJGI|TC81109 similar to UniRef100_Q9XFL4 Cluster: Peroxidase...    56   4e-07
gnl|LJGI|TC76465 similar to UniRef100_Q40372 Cluster: Peroxidase...    56   4e-07
gnl|LJGI|TC57867 similar to UniRef100_Q9XFL4 Cluster: Peroxidase...    56   4e-07

>gnl|LJGI|TC59155 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
           precursor; n=1; Arachis hypogaea|Rep: Cationic
           peroxidase 1 precursor - Arachis hypogaea (Peanut),
           partial (96%)
          Length = 1209

 Score = 87.7 bits (44), Expect = 1e-16
 Identities = 83/96 (86%)
 Strand = Plus / Plus

                                                                       
Query: 190 ctccgtcttcatttccatgactgctttgttaatggatgtgatgcatcggttctattagat 249
           |||||||||||||||||||| ||||||||| | || |||||||||||  | || || |||
Sbjct: 251 ctccgtcttcatttccatgattgctttgttcaaggttgtgatgcatcaatactgttggat 310

                                               
Query: 250 gacacttcgagtttcacgggagagaagacagctggt 285
           ||||| || |||||||| || |||||||||||||||
Sbjct: 311 gacacatctagtttcacaggtgagaagacagctggt 346


>gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
           Stylosanthes humilis|Rep: Cationic peroxidase -
           Stylosanthes humilis (Townsville stylo), partial (95%)
          Length = 1291

 Score = 83.8 bits (42), Expect = 2e-15
 Identities = 96/114 (84%)
 Strand = Plus / Plus

                                                                       
Query: 172 cgcatgggcgcgtccttactccgtcttcatttccatgactgctttgttaatggatgtgat 231
           |||||||| || ||| | |||||||||||||||||||| ||||| ||  | |||||||||
Sbjct: 256 cgcatgggagcttccctgctccgtcttcatttccatgattgcttcgtccaaggatgtgat 315

                                                                 
Query: 232 gcatcggttctattagatgacacttcgagtttcacgggagagaagacagctggt 285
           |||||  | || || |||||||| |||| |||||| || |||||||||||||||
Sbjct: 316 gcatcaatactgttggatgacacatcgaatttcacaggtgagaagacagctggt 369


>gnl|LJGI|TC68836 similar to UniRef100_Q40372 Cluster: Peroxidase precursor; n=1;
           Medicago truncatula|Rep: Peroxidase precursor - Medicago
           truncatula (Barrel medic), partial (49%)
          Length = 578

 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 166 gaacaccgcatgggcgcgtccttactccgtcttcatttccatgactgctttgttaatgga 225
           ||||| ||||| || || |||||||| ||| | ||||||||||||||||||||||| || 
Sbjct: 185 gaacaacgcattggagcatccttactacgtttgcatttccatgactgctttgttaacggt 244

                                           
Query: 226 tgtgatgcatcggttctattagatgacacttc 257
           ||||||| |||  ||||| |||||||||||||
Sbjct: 245 tgtgatggatcacttctactagatgacacttc 276


>gnl|LJGI|TC80421 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
           precursor; n=1; Arachis hypogaea|Rep: Cationic
           peroxidase 1 precursor - Arachis hypogaea (Peanut),
           partial (61%)
          Length = 734

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 161 ccaaagaacaccgcatgggcgcgtccttactccgtcttcatttccatgactgctttgtta 220
           ||||||| | ||||||||| || ||||| || || || ||||||||||| ||||||||| 
Sbjct: 229 ccaaagagccccgcatgggggcatccttgcttcgactccatttccatgattgctttgttc 288

                           
Query: 221 atggatgtgatgcatc 236
           | ||||||||||||||
Sbjct: 289 aaggatgtgatgcatc 304


>gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase 5; n=1; Phaseolus
           vulgaris|Rep: Peroxidase 5 - Phaseolus vulgaris (Kidney
           bean) (French bean), partial (93%)
          Length = 1309

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 193 cgtcttcatttccatgactgctttgttaatggatgtgatg 232
           ||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 248 cgtcttcattttcatgattgctttgttaatggatgtgatg 287


>gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
           precursor; n=1; Arachis hypogaea|Rep: Cationic
           peroxidase 1 precursor - Arachis hypogaea (Peanut),
           partial (81%)
          Length = 896

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                       
Query: 199 catttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacacttcg 258
           ||||||||||| ||||| ||  | ||||||||||||||  | || || |||||||| |||
Sbjct: 2   catttccatgattgcttcgtccaaggatgtgatgcatcaatactgttggatgacacatcg 61

                                      
Query: 259 agtttcacgggagagaagacagctggt 285
           | |||||| || |||||||||||||||
Sbjct: 62  aatttcacaggtgagaagacagctggt 88


>gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
           Stylosanthes humilis|Rep: Cationic peroxidase -
           Stylosanthes humilis (Townsville stylo), partial (43%)
          Length = 562

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 175 atgggcgcgtccttactccgtcttcatttccatgactgctttgttaatggatgtgatgca 234
           ||||| || ||||| |||||||||||||||||||| ||||||||  | || |||||||||
Sbjct: 249 atgggtgcatccttgctccgtcttcatttccatgattgctttgtccaagggtgtgatgca 308

             
Query: 235 tc 236
           ||
Sbjct: 309 tc 310


>gnl|LJGI|TC64303 similar to UniRef100_Q43854 Cluster: Peroxidase precursor; n=1;
           Vigna angularis|Rep: Peroxidase precursor - Phaseolus
           angularis (Adzuki bean) (Vigna angularis), partial (85%)
          Length = 1402

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 193 cgtcttcatttccatgactgctttgttaatggatgtgatgcatcggttctattagatg 250
           |||||||| |||||||||||||||||| | || ||||||||||| || ||||| ||||
Sbjct: 296 cgtcttcacttccatgactgctttgttcagggttgtgatgcatcagtactattggatg 353


>gnl|LJGI|DC595608 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
           Stylosanthes humilis|Rep: Cationic peroxidase -
           Stylosanthes humilis (Townsville stylo), partial (26%)
          Length = 390

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 77/93 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 ctccgtcttcatttccatgactgctttgttaatggatgtgatgcatcggttctattagat 249
           |||||||| ||||||||||| || |||||  | ||||||||||||||  |  | || |||
Sbjct: 272 ctccgtctccatttccatgattgttttgtccaaggatgtgatgcatcaatattgttggat 331

                                            
Query: 250 gacacttcgagtttcacgggagagaagacagct 282
           ||||| |||| |||||| || ||||||||||||
Sbjct: 332 gacacatcgaatttcacaggtgagaagacagct 364


>gnl|LJGI|TC75972 weakly similar to UniRef100_Q5JBR1 Cluster: Anionic peroxidase
           swpb3; n=1; Ipomoea batatas|Rep: Anionic peroxidase
           swpb3 - Ipomoea batatas (Sweet potato) (Batate), partial
           (92%)
          Length = 995

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 202 ttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacac 254
           ||||||||||||||||| || ||||||||||||||  | ||||| ||||||||
Sbjct: 198 ttccatgactgctttgtaaacggatgtgatgcatcaatactattggatgacac 250


>gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase 71 precursor; n=1;
           Arabidopsis thaliana|Rep: Peroxidase 71 precursor -
           Arabidopsis thaliana (Mouse-ear cress), partial (65%)
          Length = 1340

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 370 tgtgcagatattgttgctgttgctgctcgtgattctgttgt 410
           ||||| |||||| ||||| ||||||||||||||||||||||
Sbjct: 445 tgtgctgatattcttgctcttgctgctcgtgattctgttgt 485


>gnl|LJGI|BW599977 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
           precursor; n=1; Arachis hypogaea|Rep: Cationic
           peroxidase 1 precursor - Arachis hypogaea (Peanut),
           partial (36%)
          Length = 455

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 161 ccaaagaacaccgcatgggcgcgtccttactccgtcttcatttccatgactgctttgtta 220
           ||||||| | ||||||||| || ||||| || |  || ||||||||||| ||||||||| 
Sbjct: 200 ccaaagagccccgcatgggggcatccttgcttcaactccatttccatgattgctttgttc 259

                           
Query: 221 atggatgtgatgcatc 236
           | ||||||||||||||
Sbjct: 260 aaggatgtgatgcatc 275


>gnl|LJGI|TC81109 similar to UniRef100_Q9XFL4 Cluster: Peroxidase 3; n=1; Phaseolus
           vulgaris|Rep: Peroxidase 3 - Phaseolus vulgaris (Kidney
           bean) (French bean), partial (36%)
          Length = 579

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 202 ttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacacttc 257
           ||||||||||||||||| ||||| ||||||| ||| || ||| | |||||||||||
Sbjct: 353 ttccatgactgctttgtcaatggttgtgatggatcagtactacttgatgacacttc 408


>gnl|LJGI|TC76465 similar to UniRef100_Q40372 Cluster: Peroxidase precursor; n=1;
           Medicago truncatula|Rep: Peroxidase precursor - Medicago
           truncatula (Barrel medic), partial (58%)
          Length = 666

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 199 catttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacac 254
           ||||||||||| ||||| |||||||| ||||||| ||| |||||  ||||||||||
Sbjct: 236 catttccatgattgcttcgttaatggctgtgatggatcagttctgctagatgacac 291


>gnl|LJGI|TC57867 similar to UniRef100_Q9XFL4 Cluster: Peroxidase 3; n=1; Phaseolus
           vulgaris|Rep: Peroxidase 3 - Phaseolus vulgaris (Kidney
           bean) (French bean), partial (85%)
          Length = 1329

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 202 ttccatgactgctttgttaatggatgtgatgcatcggttctattagatgacacttc 257
           ||||||||||||||||| ||||| ||||||| ||| || ||| | |||||||||||
Sbjct: 256 ttccatgactgctttgtcaatggttgtgatggatcagtactacttgatgacacttc 311