Miyakogusa Predicted Gene
- Lj0g3v0009179.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0009179.1 tr|A9B671|A9B671_HERA2 ComEC/Rec2-related protein
OS=Herpetosiphon aurantiacus (strain ATCC 23779 /
,32.91,1.8,seg,NULL,gene.g807.t1.1
(330 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC81781 homologue to UniRef100_A7PGX4 Cluster: Chromoso... 78 4e-14
gnl|LJGI|TC73067 weakly similar to UniRef100_A7P0P3 Cluster: Chr... 60 9e-09
>gnl|LJGI|TC81781 homologue to UniRef100_A7PGX4 Cluster: Chromosome chr17
scaffold_16, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr17 scaffold_16, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (50%)
Length = 809
Score = 77.8 bits (39), Expect = 4e-14
Identities = 51/55 (92%)
Strand = Plus / Plus
Query: 204 ttggctggggatgtcagtgtcattgtgttattcgatgttactcccttatccattg 258
||||||||||||||||||| ||||||| | || ||||||||||||||||||||||
Sbjct: 443 ttggctggggatgtcagtgacattgtgctgttggatgttactcccttatccattg 497
>gnl|LJGI|TC73067 weakly similar to UniRef100_A7P0P3 Cluster: Chromosome chr19
scaffold_4, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr19 scaffold_4, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (71%)
Length = 825
Score = 60.0 bits (30), Expect = 9e-09
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 289 gtgaagcctgcagttcctatgccaggttttgcagcaaagtga 330
|||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 447 gtgaagcctgcagtatctatggcaggttttgcagcaaagtga 488