Miyakogusa Predicted Gene

Lj0g3v0009179.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0009179.1 tr|A9B671|A9B671_HERA2 ComEC/Rec2-related protein
OS=Herpetosiphon aurantiacus (strain ATCC 23779 /
,32.91,1.8,seg,NULL,gene.g807.t1.1
         (330 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81781 homologue to UniRef100_A7PGX4 Cluster: Chromoso...    78   4e-14
gnl|LJGI|TC73067 weakly similar to UniRef100_A7P0P3 Cluster: Chr...    60   9e-09

>gnl|LJGI|TC81781 homologue to UniRef100_A7PGX4 Cluster: Chromosome chr17
           scaffold_16, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_16, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (50%)
          Length = 809

 Score = 77.8 bits (39), Expect = 4e-14
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 204 ttggctggggatgtcagtgtcattgtgttattcgatgttactcccttatccattg 258
           ||||||||||||||||||| ||||||| | || ||||||||||||||||||||||
Sbjct: 443 ttggctggggatgtcagtgacattgtgctgttggatgttactcccttatccattg 497


>gnl|LJGI|TC73067 weakly similar to UniRef100_A7P0P3 Cluster: Chromosome chr19
           scaffold_4, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr19 scaffold_4, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (71%)
          Length = 825

 Score = 60.0 bits (30), Expect = 9e-09
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 289 gtgaagcctgcagttcctatgccaggttttgcagcaaagtga 330
           ||||||||||||||  ||||| ||||||||||||||||||||
Sbjct: 447 gtgaagcctgcagtatctatggcaggttttgcagcaaagtga 488