Miyakogusa Predicted Gene
- Lj0g3v0008909.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0008909.1 tr|Q2IB25|Q2IB25_9ROSI Hexose transporter 1
OS=Juglans regia PE=2 SV=1,56.42,0,Sugar_tr,General substrate
transporter; SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
seg,NULL; S,CUFF.518.1
(1131 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS318578 similar to UniRef100_Q5K3W1 Cluster: Monosacch... 58 1e-07
gnl|LJGI|TC77152 weakly similar to UniRef100_Q5K3W1 Cluster: Mon... 58 1e-07
gnl|LJGI|TC62127 weakly similar to UniRef100_Q41144 Cluster: Sug... 58 1e-07
gnl|LJGI|FS340726 similar to UniRef100_O04249 Cluster: Sugar tra... 54 2e-06
gnl|LJGI|BP058072 similar to UniRef100_Q7XA52 Cluster: Monosacch... 54 2e-06
gnl|LJGI|TC78792 similar to UniRef100_Q7XA52 Cluster: Monosaccha... 52 8e-06
>gnl|LJGI|FS318578 similar to UniRef100_Q5K3W1 Cluster: Monosaccharide transporter;
n=1; Populus tremula x Populus tremuloides|Rep:
Monosaccharide transporter - Populus tremula x Populus
tremuloides, partial (35%)
Length = 747
Score = 58.0 bits (29), Expect = 1e-07
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 465 caatcagtcaatgccaatgtatctctctgagatggctccctacaaatac 513
|||||||||| ||||||| |||||||| ||||||||||| || ||||||
Sbjct: 617 caatcagtcagtgccaatttatctctcagagatggctccgtataaatac 665
>gnl|LJGI|TC77152 weakly similar to UniRef100_Q5K3W1 Cluster: Monosaccharide
transporter; n=1; Populus tremula x Populus
tremuloides|Rep: Monosaccharide transporter - Populus
tremula x Populus tremuloides, partial (89%)
Length = 1991
Score = 58.0 bits (29), Expect = 1e-07
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 465 caatcagtcaatgccaatgtatctctctgagatggctccctacaaatac 513
|||||||||| ||||||| |||||||| ||||||||||| || ||||||
Sbjct: 568 caatcagtcagtgccaatttatctctcagagatggctccttataaatac 616
>gnl|LJGI|TC62127 weakly similar to UniRef100_Q41144 Cluster: Sugar carrier protein
C; n=1; Ricinus communis|Rep: Sugar carrier protein C -
Ricinus communis (Castor bean), partial (41%)
Length = 762
Score = 58.0 bits (29), Expect = 1e-07
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 465 caatcagtcaatgccaatgtatctctctgagatggctccctacaaatac 513
|||||||||| ||||||| |||||||| ||||||||||| || ||||||
Sbjct: 498 caatcagtcagtgccaatttatctctcagagatggctccttataaatac 546
>gnl|LJGI|FS340726 similar to UniRef100_O04249 Cluster: Sugar transport protein 7;
n=1; Arabidopsis thaliana|Rep: Sugar transport protein 7
- Arabidopsis thaliana (Mouse-ear cress), partial (38%)
Length = 646
Score = 54.0 bits (27), Expect = 2e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 131 tctttggctatgatattgggattttaggtgtcgtgacttccatggat 177
||||||| |||||||||||||||| ||||| || ||||||||||||
Sbjct: 177 tctttggatatgatattgggatttcaggtggggttacttccatggat 223
>gnl|LJGI|BP058072 similar to UniRef100_Q7XA52 Cluster: Monosaccharide transporter;
n=1; Glycine max|Rep: Monosaccharide transporter -
Glycine max (Soybean), partial (28%)
Length = 490
Score = 54.0 bits (27), Expect = 2e-06
Identities = 48/55 (87%)
Strand = Plus / Minus
Query: 122 gtggtctcatctttggctatgatattgggattttaggtgtcgtgacttccatgga 176
|||| |||||||| ||||| |||||||| |||| ||||| ||||||||||||||
Sbjct: 408 gtggactcatcttcggctacgatattggaatttcaggtggggtgacttccatgga 354
>gnl|LJGI|TC78792 similar to UniRef100_Q7XA52 Cluster: Monosaccharide transporter;
n=1; Glycine max|Rep: Monosaccharide transporter -
Glycine max (Soybean), partial (31%)
Length = 525
Score = 52.0 bits (26), Expect = 8e-06
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 883 ttccagcagtttatcgacatcaatgtgatcatgttttacgcacctgtgttgttt 936
|||||||| |||| | ||| |||||||||||||| ||||| ||||||||||||
Sbjct: 242 ttccagcaatttactggcattaatgtgatcatgttctacgcgcctgtgttgttt 295