Miyakogusa Predicted Gene

Lj0g3v0008799.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0008799.1 Non Chatacterized Hit- tr|F0WDP9|F0WDP9_9STRA
Protein kinase putative OS=Albugo laibachii Nc14
GN=Al,50,5.1,seg,NULL,CUFF.509.1
         (334 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61083 weakly similar to UniRef100_Q9SK08 Cluster: LOB...   117   4e-26
gnl|LJGI|TC65924                                                       64   6e-10
gnl|LJGI|TC76054 similar to UniRef100_A7QBE9 Cluster: Chromosome...    50   9e-06

>gnl|LJGI|TC61083 weakly similar to UniRef100_Q9SK08 Cluster: LOB domain-containing
           protein 11; n=2; Arabidopsis thaliana|Rep: LOB
           domain-containing protein 11 - Arabidopsis thaliana
           (Mouse-ear cress), partial (12%)
          Length = 768

 Score =  117 bits (59), Expect = 4e-26
 Identities = 103/116 (88%), Gaps = 5/116 (4%)
 Strand = Plus / Plus

                                                                       
Query: 131 ttttgaattttctgcactggtgctgctctatctgtctgtttcctgatgtgccatgtctct 190
           ||||||||||||| |||||||||||||||    || ||||| |||| |||||||||||||
Sbjct: 342 ttttgaattttctacactggtgctgctct----gtttgtttgctgacgtgccatgtctct 397

                                                                   
Query: 191 attgtgggattttgtcatttgctctccctaggtgtataacagatctggttgtgagg 246
            |||||| |||  |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 398 gttgtggaattc-gtcatttgctctccttaggtgtataacagatctggttgtgagg 452


>gnl|LJGI|TC65924 
          Length = 1138

 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 24  ggagaatcgtagttcggaggggacgatgcagcggctggggggatccgaccggatctggtg 83
           |||||||||||  |||||||||| |||||||||  ||||||  ||||||  |||||||||
Sbjct: 241 ggagaatcgtaaatcggaggggatgatgcagcgattgggggactccgacttgatctggtg 182

                   
Query: 84  gatggcgg 91
           ||||||||
Sbjct: 181 gatggcgg 174


>gnl|LJGI|TC76054 similar to UniRef100_A7QBE9 Cluster: Chromosome chr13 scaffold_74,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr13 scaffold_74, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (11%)
          Length = 1256

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 67  tccgaccggatctggtggatggcgg 91
           |||||||||||||||||||||||||
Sbjct: 537 tccgaccggatctggtggatggcgg 561