Miyakogusa Predicted Gene
- Lj0g3v0007479.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0007479.1 Non Chatacterized Hit- tr|I1MY15|I1MY15_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,77.58,0,seg,NULL;
bZIP_1,Basic-leucine zipper domain; BZIP,Basic-leucine zipper domain;
coiled-coil,NULL; ba,NODE_49825_length_1495_cov_130.824753.path1.1
(1020 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64909 similar to UniRef100_Q0GPE5 Cluster: BZIP trans... 856 0.0
gnl|LJGI|BP073825 similar to UniRef100_Q0GPE5 Cluster: BZIP tran... 583 e-166
gnl|LJGI|TC78660 similar to UniRef100_O48924 Cluster: CYP83D1p; ... 151 1e-35
gnl|LJGI|TC80361 similar to UniRef100_Q0GPE9 Cluster: BZIP trans... 105 5e-22
>gnl|LJGI|TC64909 similar to UniRef100_Q0GPE5 Cluster: BZIP transcription factor
bZIP11; n=1; Glycine max|Rep: BZIP transcription factor
bZIP11 - Glycine max (Soybean), partial (17%)
Length = 804
Score = 856 bits (432), Expect = 0.0
Identities = 432/432 (100%)
Strand = Plus / Plus
Query: 589 gaattggagcacaaggtccaaactcttcagacagagacgaccacactgtccactcagttt 648
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 gaattggagcacaaggtccaaactcttcagacagagacgaccacactgtccactcagttt 60
Query: 649 accaaattacagatggatcatatcgagcttaaaaatgaaaataaggagtacaagttgagg 708
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 accaaattacagatggatcatatcgagcttaaaaatgaaaataaggagtacaagttgagg 120
Query: 709 cttcaatccttggaacagcagtctcaactgaaagatgctctgaatgagactctggatgct 768
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 cttcaatccttggaacagcagtctcaactgaaagatgctctgaatgagactctggatgct 180
Query: 769 gaggtccggcgattaaggcgtactgttgcagaagtcggtggagagaacctcctctcgagt 828
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 gaggtccggcgattaaggcgtactgttgcagaagtcggtggagagaacctcctctcgagt 240
Query: 829 ctgatgggtgaacagcgcgccattaaccagcaaatggtccatttacagcatcagccgcag 888
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 ctgatgggtgaacagcgcgccattaaccagcaaatggtccatttacagcatcagccgcag 300
Query: 889 ggccagcagaggcatttacaactgcaaaacagccattctcaggaagagagacagactcaa 948
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 ggccagcagaggcatttacaactgcaaaacagccattctcaggaagagagacagactcaa 360
Query: 949 tcacagcagattcagcacaacaatgaattccagtcccagcgccagaatggcaaagctact 1008
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 tcacagcagattcagcacaacaatgaattccagtcccagcgccagaatggcaaagctact 420
Query: 1009 gcctactgatcg 1020
||||||||||||
Sbjct: 421 gcctactgatcg 432
>gnl|LJGI|BP073825 similar to UniRef100_Q0GPE5 Cluster: BZIP transcription factor
bZIP11; n=1; Glycine max|Rep: BZIP transcription factor
bZIP11 - Glycine max (Soybean), partial (21%)
Length = 416
Score = 583 bits (294), Expect = e-166
Identities = 294/294 (100%)
Strand = Plus / Plus
Query: 1 atggatgggaagaaaaaggatgatgacctggatgatttgtttagcgcatacatgaatttg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 123 atggatgggaagaaaaaggatgatgacctggatgatttgtttagcgcatacatgaatttg 182
Query: 61 gacaacattcagaatatgagcttttctggtgtcgaagataaggatttggatagcaggact 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 183 gacaacattcagaatatgagcttttctggtgtcgaagataaggatttggatagcaggact 242
Query: 121 agtggttctaagactgttgaaagcagcgacaatgaagttgacagtcatgctaatggaaaa 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243 agtggttctaagactgttgaaagcagcgacaatgaagttgacagtcatgctaatggaaaa 302
Query: 181 gcaaccgctgctcgtgctctgggggcgagttcgagctgttcagaagagaggagggaagga 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 303 gcaaccgctgctcgtgctctgggggcgagttcgagctgttcagaagagaggagggaagga 362
Query: 241 atcaagaggagttctaatggagatatggcacccggtgtccggcatcggagaagt 294
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 363 atcaagaggagttctaatggagatatggcacccggtgtccggcatcggagaagt 416
>gnl|LJGI|TC78660 similar to UniRef100_O48924 Cluster: CYP83D1p; n=1; Glycine max|Rep:
CYP83D1p - Glycine max (Soybean), partial (42%)
Length = 975
Score = 151 bits (76), Expect = 1e-35
Identities = 76/76 (100%)
Strand = Plus / Minus
Query: 945 tcaatcacagcagattcagcacaacaatgaattccagtcccagcgccagaatggcaaagc 1004
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 975 tcaatcacagcagattcagcacaacaatgaattccagtcccagcgccagaatggcaaagc 916
Query: 1005 tactgcctactgatcg 1020
||||||||||||||||
Sbjct: 915 tactgcctactgatcg 900
>gnl|LJGI|TC80361 similar to UniRef100_Q0GPE9 Cluster: BZIP transcription factor
bZIP28; n=1; Glycine max|Rep: BZIP transcription factor
bZIP28 - Glycine max (Soybean), partial (47%)
Length = 1222
Score = 105 bits (53), Expect = 5e-22
Identities = 134/161 (83%)
Strand = Plus / Plus
Query: 463 aagaaaataatggaaaacgataaacttgcagaaattgccacgtctgatcccaagcgtgca 522
|||||||| |||| || || |||||||| || || |||| | | ||||| |||||||||
Sbjct: 380 aagaaaattatggccaatgaaaaacttgctgagatagccatggcagatccaaagcgtgca 439
Query: 523 aaaaggattttggctaatcgtctatcagctgctcgctcaaaggagcggaagacacgttac 582
|| ||||||||||| ||||| | ||||||||| || || || |||||||||| ||||||
Sbjct: 440 aagaggattttggcgaatcggcaatcagctgcacgttccaaagagcggaagatgcgttac 499
Query: 583 atttctgaattggagcacaaggtccaaactcttcagacaga 623
||||| ||| | || ||||||||||| ||||||||||||||
Sbjct: 500 atttcagaactagaacacaaggtccagactcttcagacaga 540