Miyakogusa Predicted Gene

Lj0g3v0001979.3
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0001979.3 CUFF.516.3
         (309 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012486 homologue to UniRef100_Q6W2J3 Cluster: VDAC1.3...   123   7e-28
gnl|LJGI|TC82682 homologue to UniRef100_Q6W2J3 Cluster: VDAC1.3;...   123   7e-28
gnl|LJGI|DC597999 UniRef100_O22385 Cluster: Glycine-rich protein...    96   2e-19

>gnl|LJGI|GO012486 homologue to UniRef100_Q6W2J3 Cluster: VDAC1.3; n=1; Lotus
           japonicus|Rep: VDAC1.3 - Lotus japonicus, partial (11%)
          Length = 748

 Score =  123 bits (62), Expect = 7e-28
 Identities = 78/82 (95%), Gaps = 1/82 (1%)
 Strand = Plus / Plus

                                                                       
Query: 4   gcatctctcatagcctgctccgatgcattgatttcatccactcgaccttccaattctctc 63
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 306 gcatctctcatagcctgctccgatgcattgatttcatcccctcgaccttccaattctctc 365

                                 
Query: 64  agaacttcaatgtcatctctca 85
            ||||||||||  |||||||||
Sbjct: 366 -gaacttcaatcgcatctctca 386


>gnl|LJGI|TC82682 homologue to UniRef100_Q6W2J3 Cluster: VDAC1.3; n=1; Lotus
           japonicus|Rep: VDAC1.3 - Lotus japonicus, partial (13%)
          Length = 750

 Score =  123 bits (62), Expect = 7e-28
 Identities = 78/82 (95%), Gaps = 1/82 (1%)
 Strand = Plus / Plus

                                                                       
Query: 4   gcatctctcatagcctgctccgatgcattgatttcatccactcgaccttccaattctctc 63
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 363 gcatctctcatagcctgctccgatgcattgatttcatcccctcgaccttccaattctctc 422

                                 
Query: 64  agaacttcaatgtcatctctca 85
            ||||||||||  |||||||||
Sbjct: 423 -gaacttcaatcgcatctctca 443


>gnl|LJGI|DC597999 UniRef100_O22385 Cluster: Glycine-rich protein; n=1; Oryza
           sativa|Rep: Glycine-rich protein - Oryza sativa (Rice),
           partial (6%)
          Length = 570

 Score = 95.6 bits (48), Expect = 2e-19
 Identities = 48/48 (100%)
 Strand = Plus / Plus

                                                           
Query: 1   atggcatctctcatagcctgctccgatgcattgatttcatccactcga 48
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 atggcatctctcatagcctgctccgatgcattgatttcatccactcga 570