T27D20.10    (51216..52495)

Direction: -

/gene="T27D20.10"
/note="contains similarity to rat p47 protein(GB:AB002086)"
/codon_start=1
/evidence=not_experimental
/db_xref="PID:g3377843"

position (link: detail on the area) exon phase

52495..52350 1/4 0
52214..51923 2/4 2
51864..51769 3/4 0
51608..51216 4/4 0

>T27D20
ATGTCTTCGAAAGACAAGAAACCGTCGAAGCCATCGAGTAGTCGTGGTGGAATCCGAACT
CTTTCCGATCTTAACCGTAGGTCTGGTCCTGACTCCGACAGTGATTCCGATGGTCCACAA
GAATACTACACAGGTGGTGAGAAAAGTGGTATGTTAGTTCAAGATCCATCGAAAAAAGAT
GATGTTGATGAGATATTTAATCAAGCTAGACAACTAGGAGCTGTAGAAGGACCTCTTGAG
CCACCTCCGAGTTCCAGGAGTTTCACTGGAACTGGTAGATTGCTTTCTGGTGAAAATGTG
CCTACTGGTAATCAACAGCCTGAGCCTGTTGTTCACAACATTGTTTTCTGGTCTAATGGT
TTCACTATTGATGATGGTCCTTTGAGGAAATTGGATGATCCTGAGAATGCATCGTTTCTC
GAGGTGAATGACTTTCATAGCATTCGAAAGTCTGAGTGCCCGAAAGAGCTTGAGCCTGCC
GATAGAAGAGCTCCGGTTCATGTCAACTTGATGCGAAAGGAAGAGAAATGCCCTGAAAGA
CAGAAACGTAGGGTTTCATTTCAGGGTGTTGGAAGAACTCTAGGTGGTAGCAATGAAGGT
AGCGGAAGTAGCTCACCTGTGGCTCCAGACTCCGCTCCCATTCCCATCCAAACCGAACCA
GCACCATCTCAAAGTCTTGTAATAGATGAAACCGTTCCAACCACATCGATACAGCTTAGA
CTAGCGGATGGGACACGTCTGGTGGCTAAGTTCAATCACCATCACACGGTCAACGACATT
CGCGGTTTCATTGACTCATCTCGACCTGGAGCCTCGTTGAACTACCAGCTTCAGACAATG
GGGTTCCCACCTAAGCCTTTGACTGATCTCACTCAGACCATTGAAGAAGCTGGTCTCGCC
AACTCTGTTGTTCTTCAGAAATTCTAG



[help]


Entrance