T10I14.130    (48546..51813)

Direction: -

/gene="T10I14.130"
/note="similarity to probable membrane protein YLR118c,Saccharomyces cerevisiae, PIR2:S64955"
/codon_start=1
/product="putative protein"
/db_xref="PID:e1249671"
/db_xref="PID:g2832680"

position (link: detail on the area) exon phase

51813..51666 1/11 0
51371..51319 2/11 1
51090..50967 3/11 0
50837..50689 4/11 1
50638..50531 5/11 0
50435..50357 6/11 0
50069..49728 7/11 1
49378..49326 8/11 1
49132..49009 9/11 0
48878..48757 10/11 1
48659..48546 11/11 0

>T10I14
ATGGCTCGAACTTTCATCTTGTGGCTTCACGGGTTGGGAGATTCTGGACCTGCTAATGAA
CCCATCCAAACTCAATTCAAATCCTCGGAGTTAAGTAACGCTAGTTGGCTCTTCCCTTCT
GCTCCATTCAATCCGGTTACCTGCAACAATGGTGCGGTGATGCGTTCTTGGTTTGACGTT
CCTGAACTTCCTTTTAAAGTGGGCTCTCCAATTGATGAAAGCAGCGTGCTTGAAGCAGTT
AAGAATGTTCATGCCATTATAGACCAGGAGATTGCAGAAGGAACTAATCCAGAAAACGTG
TTTATCTGTGGATTAAGCCAAGGAGGAGCATTAACCTTGGCTAGTGTTCTGCTTTACCCA
AAAACTCTTGGAGGAGGTGCCGTCCTAAGTGGATGGGTTCCATTCACTTCTTCAATCATC
AGTCAGTTTCCCGAAGAGGCTAAGAAGGTTCCTCACTTATGTTTTCTTATAAACACACCA
ATCTTGTGGTCTCATGGCACTGATGACAGAATGGTACTCTTTGAAGCTGGTCAAGCTGCT
CTTCCTTTTCTCAAAGAAGCCGGTGTTACCTGTGAATTCAAGGCATATCCTGGTCTCGGG
CACTCGATCAGCAATAAGGAGCTGAAGTATATAGAGTCATGGATCAAGAGACGGTTGAAA
GACATTCTCCAAAACAAAACATTTTTTGAGAGATCGATCTCGAGAGAAAATGGTGAAGGC
ATGCGAACAAGTAGACTGAAGAAGCCGATTGTTCTTCTCACTATCGCACTATTGAGCTCT
GTCTTCTTCTTCGCATTCTTCTTCCTAAACAAATCTGACGTATCATCTACCTCTGCTTTA
CGGAACCGAGACTCCATGGCTCGAACCTTCATCTTATGGCTTCACGGGCTAGGTGATTCC
GGACCTGCCAACGAACCCATCAAAACACTTTTCAGGTCCCAGGAGTTTAGAAACACTAAG
TGGCTCTTCCCTTCTGCTCCACCAAATCCAGTCTCTTGCAATTATGGTGCAGTGATGCCT
TCTTGGTTTGACATCCCTGAGCTTCCTCTTACTGCGGGATCTCCGAAAGATGAAAGCAGT
TTGCTTAAAGCAGTTAAGAACGTTCATGCCATTATAGATAAGGAGATTGCAGGAGGAATC
AATCCAGAAAATGTGTATATCTGTGGATTTAGCCAAGGAGGTGCATTAACCTTGGCGAGT
GTTCTTCTTTACCCTAAAACTATTGGAGGAGGTGCAGTCTTTAGCGGATGGATTCCATTC
AATTCTTCGATCACCAATCAGTTTACCGAAGATGCTAAAAAGACACCAATCTTGTGGTCT
CATGGCATTGATGACAAGACTGTACTATTCGAAGCTGGTCAAGCAGCTCTTCCTTTTCTT
CAACAAGCGGGTGTGACTTGTGAATTCAAGGTATAA



[help]


Entrance