F19F18.170    (71580..72917)

Direction: +

/db_xref="GI:4468993
/gene="F19F18.170"
/note="similarity to various predicted proteins; containsEST gb|T46070, gb|AA395653, gb|T21683, "
/codon_start=1
/product="putative protein"
/protein_id="CAB38307.1"
/db_xref="PID:e1392135"
/db_xref="PID:g4468993"
/db_xref="GI:4468993"

position (link: detail on the area) exon phase

71580..71830 1/3 0
71923..72175 2/3 2
72264..72917 3/3 0

>F19F18
ATGGGTGATGAGGCAGAGATCAAGGAACATTTAAAGCCACAAGCTTCATCTGAAACAATG
GACAAGAAACATAATGTGAAAGGGAAGAGGTTATGGCAGAAAGTCAAGTATCAATTGGTG
GAGTTTCATTCATTGCCTGCTTATTTAAGAGACAATGAGTACATCATTGGTCATTACCGA
TCCGAATGGCCGATCAAACAGATTCTTCTCAGCATCTTTACCATTCATAATGAGACTTTG
AATGTTTGGACGCACTTGATTGGGTTTTTCCTGTTTTTGGCGCTCACTATATACACTGCA
ACGAAAGTACCGAGTGTCGTGGATCTTCATTCGCTTCAACACCGTTTACCCGATTTGTTG
AGGAAAACAGATCTCCACAAACTTCATTCTGAGCTCATGGCTCGCCTTCCTTCTAGTCCA
TCTAGTTGGCATGTGATGGACCTTCTTTATAACTGTTTGCCTGAAAGATTTTCTCATGGC
AACTACACTGACATGTGTGTTCTGCATTCTGTGAGGGAAGATCTTGCAAACTTGATAGCT
CCTTTGATCTTCAGGCCAATTACTCGATGGCCGTTTTATGCATTTCTAGGTGGTGCTATG
TTCTGTCTATTAGCAAGCAGCACGTGCCACCTCCTCTCATGTCACTCCGAGCGAGTCTCC
TACATAATGCTTAGGCTTGATTACGCCGGCATCGCAGCTCTAATAGCGACTTCCTTCTAC
CCTCCGGTTTATTACTCCTTCATGTGTGATCCTTTCTTCTGCAACCTCTACTTAGGATTC
ATAACCATCTTAGGAATCGCCACTGTGCTTGTTTCTCTCCTCCCGGTTTTCCAAAGCCCG
GAGTTTCGGGTGGTGAGGGCGTCTCTGTTCTTTGGAATGGGATTCTCTGGCTTAGCTCCG
ATTCTTCACAAGCTGATAATCTTTTGGGACCAACCTGAAGCCCTTCACACGACAGGTTAT
GAGATTTTGATGGGTTTGCTTTATGGGTTAGGAGCTCTGGTTTATGCAACTAGGATCCCA
GAGAGATGGATGCCGGGTAAATTCGATATAGCAGGACATAGCCATCAGTTGTTTCATGTT
CTGGTTGTTGCTGGTGCGTTCACGCACTATAGAGCTGGGCTAGTGTATCTTAAGTGGAGA
GATATTGAAGGATGTTGA



[help]


Entrance