F16J13.150    (72796..74564)

Direction: +

/db_xref="GI:4586113
/gene="F16J13.150"
/note="ESTs GB:AA597415 and Aa597491 mark 5' end; similarity to AT-hook protein 2 - Arabidopsis thaliana, contains EST gb|AA597415, gb|Aa597491, "
/codon_start=1
/product="putative DNA-binding protein"
/protein_id="CAB40949.1"
/db_xref="PID:e1425305"
/db_xref="PID:g4586113"
/db_xref="GI:4586113"

position (link: detail on the area) exon phase

72796..73258 1/5 0
73723..73829 2/5 1
73883..74014 3/5 0
74091..74252 4/5 0
74331..74564 5/5 0

>F16J13
ATGGAGTCTACCGGAGAAGCTGTTAGATCAACCACCGGTAACGACGGTGGTATTACGGTG
GTTAGATCCGACGCGCCGTCAGATTTCCACGTAGCTCAAAGATCAGAAAGCTCAAACCAA
TCTCCCACCTCTGTCACTCCTCCTCCACCACAGCCATCGTCTCATCACACAGCTCCTCCG
CCGCTGCAAATTTCGACGGTGACGACTACGACTACGACGGCCGCGATGGAAGGTATCTCC
GGTGGACTGATGAAGAAGAAGCGTGGACGGCCAAGGAAGTATGGACCGGACGGGACTGTT
GTAGCGTTATCTCCTAAACCGATTTCATCAGCGCCGGCGCCGTCGCATCTTCCGCCGCCG
AGTTCACACGTCATCGATTTCTCCGCTTCTGAGAAACGTAGCAAAGTGAAACCAACGAAC
TCGTTTAACAGAACAAAGTATCATCACCAAGTTGAGAATTTGGGTGAATGGGCTCCTTGC
TCCGTCGGTGGTAATTTCACACCTCATATAATCACAGTCAACACCGGCGAGGTAATCTCA
TCGGAATTTTTCTTTAGATCTAGACATCAAGATGTAACAATGAAGATAATCTCGTTTTCG
CAACAAGGACCTCGCTCTATTTGTGTTCTGTCAGCAAACGGTGTTATTTCAAGCGTTACA
CTTCGTCAGCCAGATTCCTCTGGCGGCACATTGACATACGAAGGTCGGTTTGAGATATTA
TCATTATCCGGGTCATTCATGCCTAATGATTCAGGCGGAACACGAAGTAGAACGGGAGGA
ATGAGTGTATCGTTAGCAAGTCCCGATGGACGTGTAGTAGGCGGTGGCCTCGCCGGTTTA
CTAGTAGCCGCGAGTCCGGTTCAGGTGGTTGTAGGAAGTTTTTTAGCGGGCACTGACCAT
CAAGATCAGAAACCGAAAAAGAACAAACATGATTTCATGTTGTCGAGTCCTACCGCTGCA
ATTCCTATCTCTAGTGCAGCTGATCACCGGACAATCCATTCGGTCTCGTCTCTTCCGGTC
AATAATAATACATGGCAGACTTCTTTAGCTTCCGATCCAAGAAACAAGCATACCGATATT
AATGTCAATGTAACTTGA



[help]


Entrance