C7A10.660    (69081..70975)

Direction: +

/db_xref="GI:4006897"
/db_xref="SPTREMBL:O23211
/gene="C7A10.660"
/note="similarity to vicilin (7S globulin; seed storage protein), Zamia furfuracea, PIR2:S60190; contains EST gb|Z48554, gb|Z48546, "
/codon_start=1
/product="globulin-like protein"
/protein_id="CAB16827.1"
/db_xref="PID:e1359096"
/db_xref="PID:g4006897"
/db_xref="GI:4006897"
/db_xref="SPTREMBL:O23211"

position (link: detail on the area) exon phase

69081..69405 1/4 0
69491..69600 2/4 1
69755..69835 3/4 0
69992..70975 4/4 0

>AP22
ATGACTAGATTTGCGGTATTGCCACTCTCTGTTCTTCTTCTCGTTCTCTTGTTCCTCTGC
ACTGAGTCGTTGGCTAAGTCGGAGGAGTCTGAAGAATACGACGTCGCTGTGCCTTCATGT
TGCGGGTTTTCGTCTCCTCTTCTGATTAAGAAAGATCAATGGAAACCAATCTTCGAGACG
AAGTTTGGACAGATCTCAACCGTTCAAATCGGCAATGGATGCGGTGGAATGGGACCTTAC
AAGATACATTCCATAACGTTGGAGCCAAACACAATTTTGCTCCCTCTTCTTCTTCATTCC
GACATGGTCTTCTTCGTTGACTCTGGAAGTGGGATTCTGAATTGGGTTGACGAGGAAGCG
AAGAGTACCGAGATCAGACTAGGAGACGTTTACAGGCTACGTCCCGGTTCGGTTTTCTAC
TTACAGAGCAAACCGGATCCTTGCTTTGGTGCCTATTCGAGTATCACAGATCTAATGTTT
GGTTTTGATGAGACAATTCTCCAGTCAGCTTTTGGGGTTCCTGAGGGGATTATAGAGCTG
ATGAGGAACCGTACGAAGCCACCATTGATCGTGAGTGAGACGCTTTGCACACCAGGTGTG
GCCAACACTTGGCAGCTCCAACCGCGATTACTAAAGCTCTTTGCTGGAAGTGCAGACTTG
GTGGATAACAAGAAGAAGAAAGAGAAGAAAGAGAAGAAGGAGAAGGTGAAGAAAGCGAAG
ACATTCAATGTTTTCGAATCTGAACCGGATTTCGAGAGCCCCTACGGTCGTACTATAACG
ATTAACAGGAAGGATCTGAAAGTTTTAAAAGGCTCAATGGTTGGAGTTTCCATGGTGAAT
CTCACTCAAGGATCGATGATGGGACCGCACTGGAATCCATGGGCTTGCGAGATTTCGATT
GTATTGAAAGGAGCAGGAATGGTTAGGGTTCTTAGGTCTTCGATATCATCAAACACATCA
TCAGAGTGTAAGAACGTGAGGTTTAAAGTAGAGGAAGGAGATATTTTCGCAGTTCCACGG
TTACATCCAATGGCTCAAATGTCTTTCAACAATGACTCGTTAGTGTTCGTTGGGTTTACT
ACTTCAGCTAAGAATAACGAGCCGCAGTTCTTAGCCGGGGAGGACTCGGCTTTGCGGATG
CTTGACCGGCAAGTATTGGCTGCATCGCTTAATGTGAGTAGTGTGACGATTGATGGATTG
TTGGGAGCTCAGAAGGAAGCTGTTATCTTGGAATGTCATTCTTGTGCGGAAGGAGAGATA
GAGAAGCTTAAGGTGGAGATAGAGAGGAAGAAAATAGATGATGAGAGGAAGAGGAGACAT
GATGAAAGGAAGAAAGAAGAAGAAGAGGCGAAGAGAGAAGAGGAAGAGAGGAGGAAACGT
GAAGAAGAAGAAGAGAAGAAGCGGTGGCCACCTCAACAACCACCACAAGAAGAAGAACTT
AGGGAACGGCAACTACCGATGGAGAAAGAATGGGAAATGGAAGGTGAAGAGGAGAGTTAA



[help]


Entrance