C7A10.620    (53104..54769)

Direction: +

/db_xref="GI:4006894"
/db_xref="SPTREMBL:O23208
/gene="C7A10.620"
/note="similarity to L.esculentum mRNA for homeobox protein, PATchX:E218587; Contains 'Homeobox' domain signature and profile Homeobox_1 [LAAELGLDPRQVAVWFQNRRARWK]"
/codon_start=1
/product="homeodomain protein"
/protein_id="CAB16824.1"
/db_xref="PID:e1359093"
/db_xref="PID:g4006894"
/db_xref="GI:4006894"
/db_xref="SPTREMBL:O23208"

position (link: detail on the area) exon phase

53104..53185 1/3 0
53531..53859 2/3 1
54527..54769 3/3 0

>AP22
ATGAACTACACGGTGGATGATCAGAACATGGCTTTTATCTCTCAACTGTACCCTGATGTC
TACACTCAGATAGTACAACCAGTAGGAGAAGTGAAGCAGCCGAAGCGGAGGAGGAAGAAG
ACCAAAGGATCCGTGGCTTCCGCAGATGGAGGCAACGGTTTGTTTAGAAAGAGGAAGCTG
ACCGATGAACAAGTGAACATGTTGGAGATGAGTTTTGGGGATGAACACAAACTTGAGTCG
GAGAGGAAAGATAGACTTGCGGCAGAGCTAGGGCTTGACCCTCGTCAAGTTGCCGTTTGG
TTTCAGAACCGTCGCGCACGGTGGAAGAACAAAAGGCTCGAGGAAGAGTACAATAAACTC
AAGAACTCACATGATAACGTCGTTGTCGACAAGTGCCGACTTGAATCTGAGGTTATTCAG
CTCAAAGAACAACTCTATGATGCAGAGAGGGAAATCCAAAGATTAGCAGAAAGAGTAGAA
GGAGGCTCAAGCAACAGTCCAATTTCGTCTTCCGTTTCCGTCGAAGCTAATGAAACGCCA
TTTTTTGGAGACTATAAAGTCGGAGATGATGGCGATGACTATGATCACTTGTTTTATCCG
GTGCCGGAAAATAGTTACATCGATGAAGCGGAATGGATGAGTCTATACATATAA



[help]


Entrance