C7A10.570    (31113..33057)

Direction: -

/db_xref="GI:2464901"
/db_xref="SPTREMBL:O23203
/gene="C7A10.570"
/note="similar to hypothetical protein, Synechocystis sp., PIR2:S76669"
/codon_start=1
/product="putative protein"
/protein_id="CAB16804.1"
/db_xref="PID:e353203"
/db_xref="PID:g2464901"
/db_xref="GI:2464901"
/db_xref="SPTREMBL:O23203"

position (link: detail on the area) exon phase

33057..32957 1/5 0
32732.. 32435 2/5 2
32362..32067 3/5 0
31984..31812 4/5 2
31714..31113 5/5 1

>AP22
ATGGGTCATGCTCGAACTCGTACCGGTATCATCTCCGTCGCTTTTAAATTCTTCAGGTCT
CTGTTCCCTCGCCATCACCGTACTAACAGCATGAAGATAAAAACAGGAACGTTTTTGGGG
GTTTCGATATCATTGATTCTTATAAACTTAGCTGCGATCATGGAACGTGCAGACGAGAAT
CTATTGCCTTCGGTTTATAAAGAAGTGAGTGAAGCATTTAACGCAGGACCATCAGATTTA
GGCTACTTAACATTCGTTAGAAACTTTGTTCAAGGACTTGCATCACCATTAGCAGGAGTT
CTTGTCATTACCTATGATCGTCCCATTGTTCTTGCAATAGGTACTTTCTGTTGGGCTTTA
TCAACTGCTGCAGTTGGAGCCAGCAGCTACTTCATTCAGGTTGCTTTATGGAGAGCAGTG
AATGGTTTTGGATTGGCAATTGTTATACCCGCGCTTCAATCGTTTATTGCAGATAGTTAT
AAGGATGGTGCGAGAGGAGCTGGTTTCGGAATGTTGAACCTCATTGGTACAATCGGTGGT
ATAGGAGGAGGTGTTGTAGCAACTGTTATGGCTGGTTCAGAGTTTTGGGGCATACCGGGA
TGGCGTTGTGCTTTTATAATGATGGCAGCGCTCAGCGCAGTGATCGGATTACTTGTCTTT
CTCTTCGTTGTTGACCCGAGAAAGAACATTGAACGAGAGGAACTAATGGCTCATAAGATG
AATTCGAACTCGGTTTGGAATGATTCATTAGCAGCTGCAAAATCTGTCGTCAAAGTAAGT
ACCTTTCAGATAATCGTCGCGCAAGGAATCATTGGTTCGTTTCCGTGGACCGCGATGGTT
TTCTTTACAATGTGGTTTGAGCTTATTGGCTTCGATCATAACCAGACTGCAGCTTTGCTT
GGGGTATTTGCTACAGGAGGAGCGATAGGAACATTAATGGGAGGGATAATAGCGGATAAA
ATGTCGCGGATATATCCGAATTCGGGTAGAGTGATGTGTGCGCAGTTCAGTGCATTCATG
GGAATCCCATTCTCTATTATTCTTCTGAAAGTAATCCCACAAAGCACAAGCAGCTACTCA
ATCTTCTCGATAACTCTCTTCCTGATGGGTCTTACCATAACTTGGTGCGGATCAGCGGTC
AATGCACCAATGTTTGCAGAAGTCGTTCCTCCAAGGCACCGTACAATGATCTACGCGTTT
GACCGTGCTTTCGAAGGGTCATTCTCATCTTTTGCTGCGCCTTTGGTTGGAATTTTGTCA
GAGAAACTGTTTGGGTATGACTCAAGAGGTATTGATCCTTTGAAAGGTTCCTCTGTTCGT
GAGGCTGATGCCCTTTCAAAGGGGCTTCTGTCAATGATGGCTGTTCCGTTTGGGCTCTGT
TGTCTCTGTTACACTCCGTTGCATTTTGTTTTCCAGAAAGATCGAGAAAACGCGAAAATC
GCGAGCTCTAAAGAAACTGAAATGATCTGA



[help]


Entrance