C7A10.820    (124454..126005)

Direction: -

/db_xref="GI:4006909"
/db_xref="SPTREMBL:O23226
/gene="C7A10.820"
/note="Contains Beta-transducin family Trp-Asp (WD-40) repeats signature [TSLGAKDHTSSSWET]; contains EST gb|T42696, "
/codon_start=1
/product="putative protein"
/protein_id="CAB16839.1"
/db_xref="PID:e1359108"
/db_xref="PID:g4006909"
/db_xref="GI:4006909"
/db_xref="SPTREMBL:O23226"

position (link: detail on the area) exon phase

126005.. 125995 1/6 0
125697..125430 2/6 2
125344..125165 3/6 0
125072.. 124866 4/6 0
124781..124641 5/6 0
124549..124454 6/6 0

>AP22
ATGACCACATGGCTTAAGTGGCTGCAACAGCAACAAATGGTTTCACCTGAGTTTCTTCAG
ATACTTGGCTCAGATGGGAGAGAAGAGCTCAAAAGAGTTGAGAGTTACTTGGGAAACAAC
AATGATGAGCTGCAGAGTTTCAGACATTTTCCCGAATTCGGACCGGATTATGATACTACT
GATGGCTGCATTTCTAGGACAAGTAGCTTCCATATGGAGCCAGTGAAGAATAATGGACAC
AGCAGAGCCATTACCTTGCAGAACAAGAGAAAACCAGAGGGTAAGACAGAAAAGAGAGAG
AAGAAGAAGATCAAAGCAGAGGATGAAACAGAGCCAAGCATGAAAGGGAAATCAAACATG
AGTAACACAGAGACATCTTCAGAAATTCAGAAACCAGATTACATTCATGTTAGGGCTAGA
CGAGGTGAAGCCACCGACAGACATAGCTTAGCAGAGAGGGCAAGAAGAGAAAAGATAAGC
AAGAAGATGAAATGTCTACAAGATATTGTTCCTGGATGCAACAAAGTTACTGGAAAAGCT
GGTATGCTTGATGAGATCATCAACTATGTCCAATCTCTGCAACAACAAGTCGAGTTCTTG
TCGATGAAACTCTCTGTCATAAATCCAGAACTTGAGTGTCATATCGATGATTTATCCGCA
AAACAGTTTCAGGCTTACTTCACAGGTCCTCCAGAAGGTGACTCGAAGCAGTCAATCATG
GCGGATTTTCGGTCTTTTCCATTACATCAGCAAGGATCTTTAGATTACTCAGTCATAAAC
TCAGACCACACCACATCTCTCGGCGCTAAAGATCATACATCATCAAGCTGGGAAACTCAC
TCACAGTGTCTTTACAACAGCTTGAGAACCGATTCTGTTTCCAATTTCTTCAGCCTCAAG
TAA



[help]


Entrance