C7A10.780    (108756..111459)

Direction: -

/db_xref="GI:4006905"
/db_xref="SPTREMBL:O23223
/gene="C7A10.780"
/note="similarity to VCP-like ATPase, Thermoplasma acidophilum, PATX:G1916752; Contains ATP
/GTP-binding site motif A (P-loop) [GPPGTGKT]"
/codon_start=1
/product="ATPase-like protein"
/protein_id="CAB16835.1"
/db_xref="PID:e1359104"
/db_xref="PID:g4006905"
/db_xref="GI:4006905"
/db_xref="SPTREMBL:O23223"

position (link: detail on the area) exon phase

111459..111181 1/8 0
111030..110935 2/8 0
110827.. 110717 3/8 0
110623..110314 4/8 0
110204..110114 5/8 1
109941.. 109647 6/8 2
109567..109419 7/8 0
109287..108756 8/8 2

>AP22
ATGGCTGCTTCTAGATTGTGTTCCGCGGCGGCGATAGCTGCTGCGTTCACTTCAATGTCA
ATGTCTCAGAACCGTGCTTACGCCGATTCTTCTCGATTCCGGTTTCCTTTCTTTTCTTCT
TCTCCTTCTCCTCCTCCGTCAGATTCTCCGGCGAATCAATCTTCATCGAAGTCTAAAGCA
GAGCCTGATGAGCCTAAAGGATCGGGTTTTGATCCTGAGGCTCTTGAGAGAGCTGCTAAA
GCTCTTAGAGATATCAATAGCTCTCCCCATTCCAAGCAGGTGTTTGATCTCATGAGGAAG
CAGGAGAAAACTCGGTTAGCTGAATTAACGGCAGAGACTTCTCATTACGAAGCTATTCAA
GCACACAATGATATTGGCAGACAGCAGAAATTGGCTGAGGACCAGAGAAATCTTTTGCAG
ACACAGGCGCAAACCAAAGCGCAAAATCTGCGATATGAGGATGAATTGGCCAGAAAGAGA
CAGCAGACAGATCATGAAGCTCAGAGGCATCATAATGTGGAATTGGTTAAGATGCAAGAG
GCGTCTTCTATCAGGAAAGAGAAGGCAAAAATCGCCACAGAAGAACAGATCCAAGCTCAG
CATCGCCAAACTGAGAAAGAGAGAGCTGAACTTGAGCGAGAGACGATTCGTGTCAAGGCC
ATGGCTGAAGCTGAAGGTCGGGCTCATGAAGCCAAACTTACTGAAGAGCAAAACAGAAGA
TTGCTTATGGAAAGGATTAATGGTGAAAGAGAGAAGTGGCTTGCTGCAATCAACACAATG
TTCAGTCACATCGAAGGGGGATTCAGGACCTTATTAACTGATCGAAATAAGCTGATTATG
ACTGTTGGAGGAGCTACTGCATTAGCTGCAGGGGTTTATACAACTCGGATGCTTGGACAA
CCGTCACTTATTCGAGAATCTTCCATGCGTAGATTTCCATGGACAGGCTCAGTGTCTCAA
TTTAAGAACAGGATCTCAGGGGCTGCAGCAGCTTCTGCAGCAGAAGGCAAAAAGCCGCTT
GATAATGTAATTCTCCATACTTCTTTGAAGAAACGAATCGAGCGTCTCGCTAGAGCTACA
GCAAACACCAAATCCCATCAAGCACCATTCCGCAACATGATGTTTTATGGACCTCCTGGT
ACCGGTAAAACTATGGTGGCAAGGGAAATAGCTCGGAAATCGGGTCTGGATTATGCTATG
ATGACAGGAGGTGATGTTGCTCCCTTGGGATCACAAGCTGTTACTAAAATCCATCAGATA
TTTGATTGGGCTAAGAAATCGAACAAAGGCTTACTTCTTTTCATTGATGAAGCCGATGCT
TTTCTATGCGAGCGTAACAGCACTTACATGAGTGAGGCTCAACGTAGTGCTCTGAACGCT
TTGCTCTTCCGAACTGGTGATCAATCTCGGGACATTGTTCTTGTCTTGGCTACAAACAGA
CGTGGAGATCTCGATAGTGCGGTTACAGACAGGATTGATGAAGTCATTGAGTTCCCACTT
CCAGGGGAAGAAGAACGTTTCAAGCTTCTCAATCTCTATCTCAACAAATATCTAAAGATG
GGTGATAACAACGAAGACACAAAACCGAAATGGAGTCATTTGTTTAAGAAGCTGTCACAG
AAGATTACCGTTGAAGAAGACTTAACTGATAAAGTGATTTCTGAGGCTGCAAAGAAGACA
GAAGGATTCTCTGGCCGTGAGATTGCAAAGCTTGTGGCTGGAGTACAAGCTGGAGTGTAC
GGACGAGCGGATTGTGTTTTGGATTCACAGCTTTTTAAAGAGATTGTTGAATATAAGGTT
GAAGAACATCACCGAAGGCATATGCTTGCTTCTGAAGGTTTTCAGCCATTACTCTTCTCT
TAG



[help]


Entrance