Jatropha Genome Database
- JcPR03ASM3X.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcPR03ASM3X.10 + phase: 1 /partial
(287 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30094.m000670 cation-transporting atpase plant, putative 163 7e-40
30170.m013745 cation-transporting atpase plant, putative 80 8e-15
29937.m000200 cation-transporting atpase plant, putative 76 1e-13
29661.m000916 cation-transporting atpase plant, putative 54 5e-07
>30094.m000670 cation-transporting atpase plant, putative
Length = 3114
Score = 163 bits (82), Expect = 7e-40
Identities = 217/262 (82%)
Strand = Plus / Plus
Query: 1 agctaaatggagttgcaacaattattgggaaaattggtttagcttttgcaataatgacgt 60
|||| |||||||| || |||||||| |||||||| ||||||||||||||| ||| || |
Sbjct: 1034 agcttaatggagtggcgacaattatcgggaaaataggtttagcttttgcagtaacaacat 1093
Query: 61 ttttggttttaatgggaaggtttttaatgactaaggcacgaaataacgaaatcatgaaat 120
|||||||| | |||||||||||| || | | |||||||| || | || || | |||
Sbjct: 1094 ttttggttatgatgggaaggtttctattagcgaaggcacgccatcatgagattacagaat 1153
Query: 121 ggtctgcgagtgatgcattgactgttctgaatttctttgctattgcagttactataattg 180
||||||| ||||||||| || || | |||||||||||| ||||||| ||||||||||
Sbjct: 1154 ggtctgctagtgatgcaatgcaggtcttaaatttctttgctgttgcagtgactataattg 1213
Query: 181 ttgttgcagttcctgagggacttcctttagcagtgacattaagtcttgcatttgcaatga 240
|||||||||| ||||| || |||||||| ||||| ||| | |||||||||||||||||||
Sbjct: 1214 ttgttgcagtccctgaagggcttcctttggcagtaacactgagtcttgcatttgcaatga 1273
Query: 241 agcaattgatgaaagacagagc 262
|| |||| ||||| ||||||||
Sbjct: 1274 agaaattaatgaacgacagagc 1295
>30170.m013745 cation-transporting atpase plant, putative
Length = 2751
Score = 79.8 bits (40), Expect = 8e-15
Identities = 55/60 (91%)
Strand = Plus / Plus
Query: 183 gttgcagttcctgagggacttcctttagcagtgacattaagtcttgcatttgcaatgaag 242
||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| ||||||
Sbjct: 919 gttgcagttcctgaggggcttcccttagctgtgacattaagtcttgcttttgccatgaag 978
>29937.m000200 cation-transporting atpase plant, putative
Length = 2904
Score = 75.8 bits (38), Expect = 1e-13
Identities = 83/98 (84%)
Strand = Plus / Plus
Query: 145 ttctgaatttctttgctattgcagttactataattgttgttgcagttcctgagggacttc 204
||||||| | |||||| |||||||| || || ||||| ||||| |||||||| ||| | |
Sbjct: 983 ttctgaactactttgcaattgcagtaaccattattgtcgttgctgttcctgaaggattac 1042
Query: 205 ctttagcagtgacattaagtcttgcatttgcaatgaag 242
| ||||||||||| || |||||||| ||||||||||||
Sbjct: 1043 cattagcagtgactttgagtcttgcctttgcaatgaag 1080
Score = 50.1 bits (25), Expect = 7e-06
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 1 agctaaatggagttgcaacaattattgggaaaattggtttagcttttgc 49
|||| ||||| || || ||||||||||| ||||||||||| ||||||||
Sbjct: 839 agctgaatggtgtcgctacaattattggaaaaattggtttggcttttgc 887
>29661.m000916 cation-transporting atpase plant, putative
Length = 2625
Score = 54.0 bits (27), Expect = 5e-07
Identities = 66/79 (83%)
Strand = Plus / Plus
Query: 163 ttgcagttactataattgttgttgcagttcctgagggacttcctttagcagtgacattaa 222
|||||||||| || |||||||||||||||| ||||| ||||| | || |||||||| |
Sbjct: 779 ttgcagttacaattgttgttgttgcagttccagaggggcttccactggctgtgacattga 838
Query: 223 gtcttgcatttgcaatgaa 241
| ||||| ||||| |||||
Sbjct: 839 gccttgcctttgccatgaa 857