Jatropha Genome Database

JcPR03AHRQV.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcPR03AHRQV.10 - phase: 0 /partial
         (219 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30190.m011101 homeobox protein knotted-1, putative                    147   3e-35

>30190.m011101 homeobox protein knotted-1, putative
          Length = 909

 Score =  147 bits (74), Expect = 3e-35
 Identities = 128/146 (87%)
 Strand = Plus / Plus

                                                                       
Query: 70  tccggtgaccagactcgccaacttaaggcagatatagccacccatcctctttatgaacag 129
           ||||||||||| ||||| ||||| |||||||| ||||| | ||||||| | |||||||||
Sbjct: 100 tccggtgaccaaactcgacaactaaaggcagaaatagctaaccatcctttatatgaacag 159

                                                                       
Query: 130 ttattagcagcccatgtatcttgtcttcgtgtagcaacaccgattgatcagttacctctt 189
            ||||| |||| |||||||||||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 160 ctattatcagctcatgtatcttgtctccgtgttgctacaccaattgatcagttacctctt 219

                                     
Query: 190 attgatgctcagctatcgcaatctca 215
           |||||||||||| |||| || |||||
Sbjct: 220 attgatgctcagttatcacagtctca 245