Jatropha Genome Database

JcPR01AQ3WW.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcPR01AQ3WW.10 + phase: 0 /pseudo/partial
         (372 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29970.m000973 cysteine protease, putative                             119   1e-26

>29970.m000973 cysteine protease, putative
          Length = 1101

 Score =  119 bits (60), Expect = 1e-26
 Identities = 182/216 (84%), Gaps = 5/216 (2%)
 Strand = Plus / Plus

                                                                       
Query: 97  ttgcagaaagctgtagcaaatcaacctgtcagtgttgccattgaagccagtggcatggac 156
           |||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
Sbjct: 778 ttgcagaaagctgtggcacatcagcctgtcagtgttgccattgaagccagtggcatgg-c 836

                                                                       
Query: 157 tttacagttctatcaatctggtgtgtttactggcgaatgtggtttcggcattagtatcat 216
           |||||||||||| || || ||||| || ||||| ||||| ||  || ||  ||| | |||
Sbjct: 837 tttacagttctaccagtcgggtgtattcactggtgaatgcgg-atcagccctag-accat 894

                                                                       
Query: 217 ggagttagtaatagttggatatggaactgaaaatggaactgattattggattgttagaaa 276
           |||| | || || ||||| |||||||| ||| |||| |  ||||||||| ||||||| ||
Sbjct: 895 ggag-tggttattgttggctatggaacagaagatggtatagattattggcttgttaggaa 953

                                               
Query: 277 ttcatggggtcccga-tggggtgaaaatggatatat 311
           ||||||||| |  || ||||||||||||||||||||
Sbjct: 954 ttcatggggccgtgattggggtgaaaatggatatat 989