Jatropha Genome Database

JcCD0135314.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCD0135314.10 - phase: 0 /pseudo/partial
         (221 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29684.m000326 conserved hypothetical protein                          143   5e-34
30000.m000374 conserved hypothetical protein                           74   4e-13

>29684.m000326 conserved hypothetical protein
          Length = 1203

 Score =  143 bits (72), Expect = 5e-34
 Identities = 102/112 (91%)
 Strand = Plus / Plus

                                                                        
Query: 107  agatggcagggcaggtgaaatgccacaagtatagtagacgacgtccgtctgagggttgga 166
            |||||||||||||||| |||||||||||||| |||||  ||||  | |||||||||||||
Sbjct: 983  agatggcagggcaggtaaaatgccacaagtacagtaggagacgatcttctgagggttgga 1042

                                                                
Query: 167  acttcacagtggaaaaaatgggagcacgagggaagcgcggaggtggtggtgg 218
            |||| |||||||||||||||||| ||||||||||||| ||||||||||||||
Sbjct: 1043 actttacagtggaaaaaatgggatcacgagggaagcgtggaggtggtggtgg 1094


>30000.m000374 conserved hypothetical protein
          Length = 1095

 Score = 73.8 bits (37), Expect = 4e-13
 Identities = 83/97 (85%), Gaps = 1/97 (1%)
 Strand = Plus / Plus

                                                                        
Query: 119  aggtgaaatgccacaagtatagtagacgacgtccgtctgagggttggaacttcacagtgg 178
            |||| ||||||||||||||||||||  | |||   ||||||||||||||||| |||||||
Sbjct: 983  aggtaaaatgccacaagtatagtaggaggcgttt-tctgagggttggaactttacagtgg 1041

                                                 
Query: 179  aaaaaatgggagcacgagggaagcgcggaggtggtgg 215
            | ||| ||||| || |||| ||||| |||||||||||
Sbjct: 1042 agaaactgggaccatgaggaaagcgtggaggtggtgg 1078