Jatropha Genome Database

JcCD0112693.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCD0112693.10 + phase: 0 /partial
         (189 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29728.m000799 beta-fructofuranosidase, putative                       220   2e-57
29711.m000330 beta-fructofuranosidase, putative                        92   1e-18
30170.m014184 beta-fructofuranosidase, putative                        60   5e-09

>29728.m000799 beta-fructofuranosidase, putative
          Length = 1659

 Score =  220 bits (111), Expect = 2e-57
 Identities = 165/183 (90%)
 Strand = Plus / Plus

                                                                        
Query: 7    tattatgatgggaaacttggtagatttattggtaaacaagcaagaaaatatcagacatgg 66
            |||||||||||||||||||| |||| ||| |||||||| ||||| | ||| |||||||||
Sbjct: 1474 tattatgatgggaaacttgggagatatatgggtaaacaggcaaggagataccagacatgg 1533

                                                                        
Query: 67   tcaattgctgggtacttggtggcgaaaatgatgctggaggatccttcacatttgggaatg 126
            || |||||||||||||||||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 1534 tctattgctgggtacttggtggcaaagatgatgctggaggatccttcgcatttgggaatg 1593

                                                                        
Query: 127  atttcactcgaagaggacaagcaaatgaagccagtgatcaggagatcatcttcttggact 186
            ||||| || ||||||||||||||||||||||||||| | |  |||||| |||||||||||
Sbjct: 1594 atttctcttgaagaggacaagcaaatgaagccagtgcttaaaagatcaacttcttggact 1653

               
Query: 187  tgc 189
            |||
Sbjct: 1654 tgc 1656


>29711.m000330 beta-fructofuranosidase, putative
          Length = 1605

 Score = 91.7 bits (46), Expect = 1e-18
 Identities = 130/158 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    cctgagtattatgatgggaaacttggtagatttattggtaaacaagcaagaaaatatcag 60
            ||||| |||||||||||||| |||||  |||| ||||| || |||||  | |||| ||||
Sbjct: 1414 cctgaatattatgatgggaagcttggccgattcattggaaagcaagcccggaaatttcag 1473

                                                                        
Query: 61   acatggtcaattgctgggtacttggtggcgaaaatgatgctggaggatccttcacatttg 120
            || ||||| || || || |||||||| || |||||||||||||| |||||||| ||||||
Sbjct: 1474 acctggtccatcgcaggttacttggtagcaaaaatgatgctggaagatccttcccatttg 1533

                                                  
Query: 121  ggaatgatttcactcgaagaggacaagcaaatgaagcc 158
            || ||| |  |||| || || ||||| |||||||||||
Sbjct: 1534 ggtatggtggcacttgaggaagacaaacaaatgaagcc 1571


>30170.m014184 beta-fructofuranosidase, putative
          Length = 1482

 Score = 60.0 bits (30), Expect = 5e-09
 Identities = 81/98 (82%)
 Strand = Plus / Plus

                                                                        
Query: 58   cagacatggtcaattgctgggtacttggtggcgaaaatgatgctggaggatccttcacat 117
            ||||||||||| ||||| |||||||| ||||| || ||||||||||| ||||| || |||
Sbjct: 1348 cagacatggtctattgccgggtacttagtggccaagatgatgctggaagatccatctcat 1407

                                                  
Query: 118  ttgggaatgatttcactcgaagaggacaagcaaatgaa 155
             | || || || ||||| || || || |||||||||||
Sbjct: 1408 cttggtattatatcacttgaggaagataagcaaatgaa 1445