Jatropha Genome Database

JcCD0099951.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCD0099951.10 - phase: 0 /partial/short
         (148 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29815.m000491 ubiquitin-protein ligase, putative                      176   2e-44

>29815.m000491 ubiquitin-protein ligase, putative
          Length = 3447

 Score =  176 bits (89), Expect = 2e-44
 Identities = 135/149 (90%), Gaps = 1/149 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    atcaagactgaagtcatccattcacgtt-cttttgttagtgaatgtggcattccagaggc 59
            ||||||| |||||||||| ||||| ||| | |||||||||||||||||| ||||||||||
Sbjct: 2463 atcaagattgaagtcatcgattcatgtttcatttgttagtgaatgtggcgttccagaggc 2522

                                                                        
Query: 60   tggcttggactatggtggattatcaaaggagtttctgactgatatatcaaaagcagcctt 119
            ||| || ||||||||||||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 2523 tggtttagactatggtggattatcaaaggagtttctaactgatatatcaaaagcatcctt 2582

                                         
Query: 120  ttctccagagtatggcctattctcccaaa 148
            ||| || ||||| || |||||||||||||
Sbjct: 2583 ttcccctgagtacggtctattctcccaaa 2611