Jatropha Genome Database
- JcCD0092337.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCD0092337.10 - phase: 0 /pseudo/partial
(269 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30162.m001300 pantothenate kinase, putative 181 2e-45
>30162.m001300 pantothenate kinase, putative
Length = 1104
Score = 181 bits (91), Expect = 2e-45
Identities = 130/143 (90%)
Strand = Plus / Plus
Query: 7 ttggctgctaatgacttgccttctattaatgatgtcacttaccctgaactgattgagatt 66
|||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||
Sbjct: 736 ttggctgctaatgacttgccctctatcaacgatgtcacttaccctgaactgattgagatt 795
Query: 67 atattgaagttgaaagatggaagtggacagcttgttggtgtagatgcctctaatcttttg 126
|||| ||||||||||||| || |||||||||||| ||||| ||| |||||||||| |||
Sbjct: 796 atatcaaagttgaaagatgaaaatggacagcttgtgggtgttgatacctctaatctcttg 855
Query: 127 attgccaattccggaaatgattt 149
|||||||| || |||||||||||
Sbjct: 856 attgccaactctggaaatgattt 878