Jatropha Genome Database

JcCD0081914.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCD0081914.10 + phase: 0 /partial
         (207 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30128.m008623 Zeta-carotene desaturase, chloroplast precursor, p...   117   3e-26

>30128.m008623 Zeta-carotene desaturase, chloroplast precursor,
           putative
          Length = 2895

 Score =  117 bits (59), Expect = 3e-26
 Identities = 83/91 (91%)
 Strand = Plus / Plus

                                                                       
Query: 85  gtggatatatatgaatcaaggtctttcattggtggtaaagtgggttcatttgtcgataaa 144
           ||||| ||||||||||||||| | || |||||||||||||||||||||||||| || | |
Sbjct: 313 gtggacatatatgaatcaaggacctttattggtggtaaagtgggttcatttgtggacaga 372

                                          
Query: 145 cgtgggaatcacattgaaatgggacttcatg 175
           ||||| |||||||||||||||||||||||||
Sbjct: 373 cgtggaaatcacattgaaatgggacttcatg 403