Jatropha Genome Database

JcCD0062083.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCD0062083.10 + phase: 0 
         (222 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m008987 conserved hypothetical protein                          143   5e-34

>30174.m008987 conserved hypothetical protein
          Length = 267

 Score =  143 bits (72), Expect = 5e-34
 Identities = 145/168 (86%), Gaps = 1/168 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggacacggagctgagggcgcccatgggggacttcagggggaaagtgtggagcatgagt 60
           ||||||||||||||||||| || ||||| | | ||||| | ||| ||||||||||||  |
Sbjct: 14  atggacacggagctgagggagctcatggag-atttcagagcgaaggtgtggagcatgcct 72

                                                                       
Query: 61  ggaggtccatactgcaggcccaagcattggcgccgtaacactgccatcgctatggctagc 120
           ||||| ||||| ||||| ||||| || |||||||| |||||||| ||||| |||||| ||
Sbjct: 73  ggaggcccatattgcagacccaaacactggcgccgcaacactgctatcgccatggctggc 132

                                                           
Query: 121 gttttcctgatctgcatccctatcgccatgaaatctgcagagctcgag 168
            | |||||  ||||||||||||||||||||||||||||||||||||||
Sbjct: 133 ctcttcctcgtctgcatccctatcgccatgaaatctgcagagctcgag 180