Jatropha Genome Database

JcCC0332622.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCC0332622.10 - phase: 0 
         (240 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28153.m000283 glutathione peroxidase, putative                         86   1e-16

>28153.m000283 glutathione peroxidase, putative
          Length = 4677

 Score = 85.7 bits (43), Expect = 1e-16
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgggatctagcataaagtggaattttacgaagtttttaatcaacagggaagggcaagtc 60
            ||||| ||| ||||||| |||||||||||||||||| || |||  | ||| |||||||||
Sbjct: 4546 atggggtctggcataaaatggaattttacgaagtttctagtcagtaaggatgggcaagtc 4605

                                               
Query: 61   atcaatcgctatggcccaaccaccaatcctttgtc 95
            ||||| || ||||| |||||||||| |||||||||
Sbjct: 4606 atcaaccgatatggaccaaccaccagtcctttgtc 4640