Jatropha Genome Database

JcCB1007071.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB1007071.10 + phase: 0 /partial/short
         (100 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27613.m000621 Calcium-binding protein, putative                        90   3e-18

>27613.m000621 Calcium-binding protein, putative
          Length = 1026

 Score = 89.7 bits (45), Expect = 3e-18
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                
Query: 8   tgaccaggcacaaatccacggttgctggatttctttcaaaaaattatgattgg 60
           ||||||||||||| ||||| |||||||||||||||||||||||||||||||||
Sbjct: 581 tgaccaggcacaagtccacagttgctggatttctttcaaaaaattatgattgg 633