Jatropha Genome Database

JcCB0969321.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0969321.10 - phase: 0 /partial/short
         (118 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29737.m001226 calmodulin binding protein, putative                    145   6e-35

>29737.m001226 calmodulin binding protein, putative
          Length = 1278

 Score =  145 bits (73), Expect = 6e-35
 Identities = 103/113 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggaaaattcaagaaacaggagagtggagaagagaggttatgagcagagtgttgaagat 60
           |||||||||||||||   ||||||||||| || |||||||||||||||||||||||||||
Sbjct: 1   atggaaaattcaagaggaaggagagtggataaaagaggttatgagcagagtgttgaagat 60

                                                                
Query: 61  gaatctgaccacttgcctgatccaaagaaggcaaagttgcctgctttagcaag 113
           |||  | ||||||||||||||||||| ||||||||| ||||||||||||||||
Sbjct: 61  gaagataaccacttgcctgatccaaaaaaggcaaagatgcctgctttagcaag 113