Jatropha Genome Database

JcCB0914631.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0914631.10 + phase: 0 /partial
         (159 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30209.m001534 homogentisate 1,2-dioxygenase, putative                  78   2e-14

>30209.m001534 homogentisate 1,2-dioxygenase, putative
          Length = 1374

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                        
Query: 5    aggctaccatcgcacgtggaaatgatgcaggaccatataaaatcacagatacaatggctt 64
            |||||||||| ||||| || ||||||||||||||   || |||||| ||||||||||| |
Sbjct: 1172 aggctaccattgcacgcgggaatgatgcaggaccgagtagaatcactgatacaatggcct 1231

                               
Query: 65   tcatgtttgagtcatgttt 83
            |||||||||| ||||||||
Sbjct: 1232 tcatgtttgaatcatgttt 1250