Jatropha Genome Database

JcCB0896111.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0896111.10 - phase: 0 
         (240 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27504.m000635 conserved hypothetical protein                          111   2e-24

>27504.m000635 conserved hypothetical protein
          Length = 306

 Score =  111 bits (56), Expect = 2e-24
 Identities = 86/96 (89%)
 Strand = Plus / Plus

                                                                      
Query: 1  atgggtttttcaggtaagcctcaagtggataatgggttagaattggattgtaagaaatgg 60
          |||||||||||||||||| ||||||||||||||||||| |||||||||| ||| ||||||
Sbjct: 1  atgggtttttcaggtaagactcaagtggataatgggttggaattggattctaaaaaatgg 60

                                              
Query: 61 gtaattgcaggaattcctttaagagcgccattaaag 96
          || ||||| || |||||||| ||||| || ||||||
Sbjct: 61 gttattgctgggattcctttgagagctcctttaaag 96