Jatropha Genome Database
- JcCB0892281.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0892281.10 - phase: 0 /pseudo/partial
(240 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29593.m000174 conserved hypothetical protein 176 4e-44
>29593.m000174 conserved hypothetical protein
Length = 1503
Score = 176 bits (89), Expect = 4e-44
Identities = 143/161 (88%)
Strand = Plus / Plus
Query: 10 agttgcaagtatggtgccacatgccgctacaatcatcctgataggaatgcaatcaatcca 69
||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 961 agttgtaagtatggtgccacttgccgctataatcatcctgataggaatgcaatcaatcca 1020
Query: 70 cctgctgctgctataagtcatcccattgtagccaatcctgctgctaatttgaacattgga 129
||||||||||| ||| | |||||| || | ||| |||||| |||||| ||||| |||||
Sbjct: 1021 cctgctgctgcaataggccatccccttcttgcctctcctgcagctaatctgaaccttgga 1080
Query: 130 gttattaatccagctgcctctttatatcaaactattgatcc 170
| ||||||||||||||||||| |||||||| ||||| ||||
Sbjct: 1081 gatattaatccagctgcctctatatatcaagctatttatcc 1121