Jatropha Genome Database

JcCB0890131.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0890131.10 - phase: 2 /partial
         (1139 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

55107.m000015 hypothetical protein                                     90   3e-17

>55107.m000015 hypothetical protein
          Length = 1380

 Score = 89.7 bits (45), Expect = 3e-17
 Identities = 66/73 (90%)
 Strand = Plus / Plus

                                                                        
Query: 264  taggtgacttagttggatgctctgtgcgggacttaatgagaagaaagcgatgccaccgaa 323
            |||||| ||||||||||| |||||||||||| || ||||||||||||||||||| |||||
Sbjct: 1082 taggtggcttagttggatcctctgtgcgggatttgatgagaagaaagcgatgccgccgaa 1141

                         
Query: 324  tagctcagcagga 336
            |  ||||||||||
Sbjct: 1142 ttcctcagcagga 1154



 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 50  actaataagcgcaaaagggagaaatcattatggggctcattacccttctccatgacccaa 109
           |||||||||||||||||| |||| | |||||||||||| |||||| |||| |||||| ||
Sbjct: 871 actaataagcgcaaaaggaagaagttattatggggctctttacccatctcgatgaccgaa 930

             
Query: 110 aa 111
           ||
Sbjct: 931 aa 932