Jatropha Genome Database
- JcCB0836121.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0836121.10 + phase: 1 /partial
(199 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30147.m013950 conserved hypothetical protein 174 1e-43
>30147.m013950 conserved hypothetical protein
Length = 1608
Score = 174 bits (88), Expect = 1e-43
Identities = 165/188 (87%), Gaps = 2/188 (1%)
Strand = Plus / Plus
Query: 12 gcacaaccaacaaatgagattcagcagccagccagggaggaggctactaaacagagtccc 71
|||||||||||||||||||||||||| | |||||||||||||| |||||||| |||||
Sbjct: 73 gcacaaccaacaaatgagattcagcaacaagccagggaggaggtcactaaacaaagtcca 132
Query: 72 ccatctgtctttgtgaactcggaaccaatgcgagaggatcaagtgcagaatgctgtaaaa 131
||||| |||||||| ||||| || || ||| |||| |||||||||||||||||||| ||
Sbjct: 133 ccatcggtctttgtcaactcagagcctatgagagaagatcaagtgcagaatgctgt-taa 191
Query: 132 atttctttcacacccaaaaagttaggggttctccggccatgtataggcgatcctttcttg 191
||||||||| ||||| ||||||||||||||| || | |||||||||||| || |||||||
Sbjct: 192 atttctttcgcaccc-aaaagttaggggttcccctgtcatgtataggcggtcttttcttg 250
Query: 192 aaaggaag 199
| ||||||
Sbjct: 251 agaggaag 258