Jatropha Genome Database

JcCB0826111.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0826111.10 + phase: 0 /partial/short
         (143 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29827.m002559 glycine cleavage system h protein, putative              78   1e-14

>29827.m002559 glycine cleavage system h protein, putative
          Length = 498

 Score = 77.8 bits (39), Expect = 1e-14
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                      
Query: 1  atggcactaagaatgtgggcttcttctacagccaatgcactgaaaatctctgttgcctcc 60
          |||||||| ||||||||||| ||||| ||||| ||| |||| ||||||||||| |||| |
Sbjct: 1  atggcactcagaatgtgggcgtcttccacagctaatacactaaaaatctctgtagcctgc 60

                             
Query: 61 aaacctcagctctctcctt 79
          ||| |||| ||||||||||
Sbjct: 61 aaagctcaactctctcctt 79