Jatropha Genome Database

JcCB0812861.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0812861.10 - phase: 0 /partial
         (312 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29601.m000448 Late seed maturation protein P8B6, putative             299   5e-81
29814.m000729 Embryonic abundant protein, putative                    121   3e-27

>29601.m000448 Late seed maturation protein P8B6, putative
          Length = 339

 Score =  299 bits (151), Expect = 5e-81
 Identities = 262/299 (87%)
 Strand = Plus / Plus

                                                                       
Query: 13  caagaaagggctgaacttgatgctagagcaaggcaaggagagactgttgtacctggtgga 72
           |||||||| ||||||||||| |||||||| | || ||||||||||||||| |||||||||
Sbjct: 13  caagaaagagctgaacttgacgctagagctaagcgaggagagactgttgttcctggtgga 72

                                                                       
Query: 73  actggtggcaagagccttgaagcccaggaacatctagctgaagggcggagccgtggaggg 132
           |||||||||||||| |||||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 73  actggtggcaagagtcttgaagctcaagaacaccttgctgaagggcggagccgcggtgga 132

                                                                       
Query: 133 cagacaaggagggagcagctgggaactgaggggtacaaggaacttggtcaccgtggaggt 192
           ||||| || ||||||||||||||||||||||| |||||||| || ||||||   ||||| 
Sbjct: 133 cagacgagaagggagcagctgggaactgagggctacaaggagctaggtcacaaaggaggg 192

                                                                       
Query: 193 gagacaagaagggagcagattgggcatgaagggtatcaggagatgggccgaaaaggcgga 252
           || || ||||||||||||||||||  ||||||||||||||| ||||| || ||||| |||
Sbjct: 193 gaaaccagaagggagcagattgggactgaagggtatcaggaaatgggacgcaaaggtgga 252

                                                                      
Query: 253 cttagcaccatggacaagtctggtgaagaacgtgctgctgaggaggggattgaaattga 311
           |||||||| || |||||||| |||| |||||||||||||||||| ||||| ||||||||
Sbjct: 253 cttagcactattgacaagtccggtggagaacgtgctgctgaggaagggatcgaaattga 311


>29814.m000729 Embryonic abundant protein, putative
          Length = 285

 Score =  121 bits (61), Expect = 3e-27
 Identities = 109/125 (87%)
 Strand = Plus / Plus

                                                                       
Query: 43  aggcaaggagagactgttgtacctggtggaactggtggcaagagccttgaagcccaggaa 102
           |||||||| ||||||||  | || ||||| || |||||||||||||| |||||||| |||
Sbjct: 49  aggcaaggtgagactgtaatccccggtggcacaggtggcaagagcctcgaagcccaagaa 108

                                                                       
Query: 103 catctagctgaagggcggagccgtggagggcagacaaggagggagcagctgggaactgag 162
           || || ||||||||||||||||| ||||| ||||| |||| ||||||||||||||| |||
Sbjct: 109 caccttgctgaagggcggagccgaggaggtcagacgaggaaggagcagctgggaacggag 168

                
Query: 163 gggta 167
           |||||
Sbjct: 169 gggta 173