Jatropha Genome Database

JcCB0800111.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0800111.10 + phase: 0 /pseudo
         (283 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29680.m001682 conserved hypothetical protein                          113   6e-25

>29680.m001682 conserved hypothetical protein
          Length = 987

 Score =  113 bits (57), Expect = 6e-25
 Identities = 81/89 (91%)
 Strand = Plus / Plus

                                                                       
Query: 64  aattacacgaacccgtgtttgaccatgcaccagccgtgggcttcccttttagtttatggg 123
           |||||||||||||| ||||| || ||||| ||||| ||||||||||||||||||||||| 
Sbjct: 22  aattacacgaacccatgtttaacaatgcatcagccatgggcttcccttttagtttatggt 81

                                        
Query: 124 atcaagcgcattgaaggcaggtcctggcc 152
           ||||| ||||||||||||||||| |||||
Sbjct: 82  atcaaacgcattgaaggcaggtcttggcc 110