Jatropha Genome Database
- JcCB0736441.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0736441.10 - phase: 0 /partial
(812 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29713.m000178 acyl-CoA oxidase, putative 56 3e-07
>29713.m000178 acyl-CoA oxidase, putative
Length = 708
Score = 56.0 bits (28), Expect = 3e-07
Identities = 54/60 (90%), Gaps = 2/60 (3%)
Strand = Plus / Plus
Query: 745 gcaggtgatctcttaaagcaatacaagggagaagttccaaggt-ggacattggcagtgac 803
|||| |||||| || ||||||||||||| |||||||||||||| ||||| ||||||||||
Sbjct: 85 gcagctgatcttttgaagcaatacaagg-agaagttccaaggtgggacactggcagtgac 143