Jatropha Genome Database

JcCB0703071.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0703071.10 - phase: 0 
         (168 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29838.m001690 mads box protein, putative                              115   8e-26
30174.m008934 mads box protein, putative                               60   4e-09
30138.m003939 mads box protein, putative                               52   1e-06

>29838.m001690 mads box protein, putative
          Length = 186

 Score =  115 bits (58), Expect = 8e-26
 Identities = 121/142 (85%)
 Strand = Plus / Plus

                                                                       
Query: 20  agatcaagaagattgataacattacagcaaggcaagtgaccttttcgaaaagaagacgag 79
           |||||||||||||||||||||| |||||||| |||||||| ||||| || |||||| |||
Sbjct: 20  agatcaagaagattgataacataacagcaagacaagtgactttttcaaagagaagaagag 79

                                                                       
Query: 80  ggcttttcaaaaaagctgaggagctttctgttctttgcgatgctgaggttgctcttatcg 139
           |||||||||| |||||| | || || ||   |||||| ||||||||| | |||||| | |
Sbjct: 80  ggcttttcaagaaagcttatgaactatcaactctttgtgatgctgagatagctcttttag 139

                                 
Query: 140 ttttttctgctactgggaagct 161
           | |||||||||||||| |||||
Sbjct: 140 tcttttctgctactggaaagct 161


>30174.m008934 mads box protein, putative
          Length = 735

 Score = 60.0 bits (30), Expect = 4e-09
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 88  aaaaaagctgaggagctttctgttctttgcgatgctgaggttgctcttat 137
           ||||||||| | ||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 88  aaaaaagcttatgagctgtctgtgctttgtgatgctgaggttgctcttat 137


>30138.m003939 mads box protein, putative
          Length = 735

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 106 tctgttctttgcgatgctgaggttgctcttatcgttttttct 147
           |||||||||||||||||||| |||||| | || |||||||||
Sbjct: 106 tctgttctttgcgatgctgaagttgctttgattgttttttct 147