Jatropha Genome Database

JcCB0698361.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0698361.10 - phase: 0 
         (405 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013673 conserved hypothetical protein                           94   8e-19

>30170.m013673 conserved hypothetical protein
          Length = 1854

 Score = 93.7 bits (47), Expect = 8e-19
 Identities = 138/168 (82%), Gaps = 9/168 (5%)
 Strand = Plus / Plus

                                                                       
Query: 76  agttcagatcgcgaaacaaagcaggagttgtacggatctgggtttcttaagcaggagaga 135
           ||||||||||  || || || ||| ||| |||||||||||||||||| ||||| || |||
Sbjct: 103 agttcagatcctgagactaaacagaagtggtacggatctgggtttctcaagcaagaaaga 162

                                                                       
Query: 136 tctgatactact------gaacatgattggaggagctctaaactgtccaaaactgagtca 189
           |||  |||||||      ||| |||||||||| |||||||||||||| |||||||| |||
Sbjct: 163 tctagtactactaccaatgaagatgattggagaagctctaaactgtcaaaaactgaatca 222

                                                           
Query: 190 atgctgcttccaca---aagaaatactttactcaaatctaatactact 234
           ||||||||  ||||   ||| | ||||||||||||||||||| |||||
Sbjct: 223 atgctgctctcacatagaagcactactttactcaaatctaatgctact 270