Jatropha Genome Database

JcCB0645591.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0645591.10 - phase: 0 /pseudo
         (285 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m014167 5'->3' exoribonuclease, putative                        230   4e-60
30073.m002213 5'->3' exoribonuclease, putative                         58   3e-08

>30170.m014167 5'->3' exoribonuclease, putative
          Length = 3342

 Score =  230 bits (116), Expect = 4e-60
 Identities = 182/204 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggtgttccggctttctatcggtggttagccgagaagtatccgttagttgtggtggat 60
           ||||| |||||||| || || ||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 1   atgggagttccggcgttttaccggtggttagccgagaaatatccattagtagtggtggat 60

                                                                       
Query: 61  gtaatcgaggaagaatcagtggttatcgatggagttaacataccagtggatacgagtaga 120
           | ||| || |||||| ||||||| |||||||||||||| || ||||||||| ||||||| 
Sbjct: 61  gcaattgaagaagaaccagtggtcatcgatggagttaagattccagtggatgcgagtagg 120

                                                                       
Query: 121 cctaatcctaacagcatcgaatatgataatttatatctcgacatgaacgggattattcac 180
           ||||| ||||||| ||||||||| |||||||||||||| || ||||||||||||||||||
Sbjct: 121 cctaaccctaacaacatcgaatacgataatttatatcttgatatgaacgggattattcac 180

                                   
Query: 181 ccttgcttccaccccgaagacaga 204
           |||||||| |||||||||||||||
Sbjct: 181 ccttgctttcaccccgaagacaga 204


>30073.m002213 5'->3' exoribonuclease, putative
          Length = 4638

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 136 atcgaatatgataatttatatctcgacatgaacgggattattcacccttgctt 188
           ||||||| ||||||| ||||||| ||||||||||| || || |||||||||||
Sbjct: 136 atcgaatttgataatctatatcttgacatgaacggaatcatccacccttgctt 188